Mycobacterium avium (MA), Mycobacterium intracellulare (MI), and Mycobacterium avium subsp. paratuberculosis (MAP) are difficult to culture due to their slow growing nature. A quantitative polymerase chain reaction (qPCR) method for the rapid detection of MA, MI, and MAP can be used to provide data supporting drinking water biofilms as potential sources of human exposure. The aim of this study was to characterize two qPCR assays targeting partial 16S rRNA gene sequences of MA and MI and use these assays, along with two previously reported MAP qPCR assays (IS900 and Target 251), to investigate Mycobacterium occurrence in kitchen faucet biofilms. MA and MI qPCR assays demonstrated 100% specificity and sensitivity when evaluated against 18 non-MA complex, 76 MA, and 17 MI isolates. Both assays detected approximately 1,000 cells from a diluted cell stock inoculated on a sampling swab 100% of the time. DNA analysis by qPCR indicated that 35.3, 56.9 and 11.8% of the 51 kitchen faucet biofilm samples collected contained MA, MI, and MAP, respectively. This study introduces novel qPCR assays designed to specifically detect MA and MI in biofilm. Results support the use of qPCR as an alternative to culture for detection and enumeration of MA, MI, and MAP in microbiologically complex samples.

INTRODUCTION

Nontuberculous mycobacteria (NTM) cause a considerable amount of waterborne illness in the USA, costing nearly $500 M in hospitalizations per year (Collier et al. 2012). NTM are the causative agents of pulmonary, skin, soft tissue, and disseminated infections, among others. Pulmonary NTM infections account for almost half of all NTM hospitalizations and are typically caused by Mycobacterium avium (MA) and Mycobacterium intracellulare (MI) (Griffith et al. 2007; Kasperbauer & Daley 2008). Although information relating risk factors to mycobacteria infection is limited, a major source of human exposure is drinking water and several reports have described occurrence of MA and MI in drinking water distribution systems (von Reyn et al. 1994; Eaton et al. 1995; Falkinham 1996, 2002, 2009; Aronson et al. 1999; Covert et al. 1999; Falkinham et al. 2001; Vaerewijck et al. 2005; Reed et al. 2006; Marciano-Cabral et al. 2010).

Recent epidemiological investigations suggest rates of NTM infection are on the rise, elevating the importance of understanding the ecology of NTM in drinking water (Marras et al. 2007; Cassidy et al. 2009). The majority of occurrence studies to date have focused on the analysis of bulk water samples using culture methods. Few studies have attempted to determine the source of mycobacteria in bulk water, but sloughing biofilm from surfaces of drinking water pipes has been implicated (Falkinham et al. 2001; Feazel et al. 2009). Unique characteristics associated with MA and MI, such as their slow growth rate, ability to survive in nutrient-poor environments, resistance to disinfectants and high temperatures, and the hydrophobicity and impermeability of their outer membrane enable them to thrive in drinking water biofilms (Taylor et al. 2000; Falkinham et al. 2001; Vaerewijck et al. 2005; Torvinen et al. 2007). However, due to their slow growth rate, culturing mycobacteria requires days to months to produce results. Over-growth of non-target organisms results in frequent sample loss. Development of a rapid molecular method such as quantitative polymerase chain reaction (qPCR) would enable faster results and detection of even the most difficult-to-culture mycobacteria. The aim of this study was to evaluate two novel qPCR assays targeting the 16S rRNA genes of MA and MI while investigating their occurrence in drinking water biofilms obtained from kitchen faucets in homes. Biofilm samples were also analyzed for Mycobacterium avium subsp. paratuberculosis (MAP) using two previously reported qPCR assays, the IS900 assay and the Target 251 assay, which is more specific but less sensitive than the former (Beumer et al. 2010). This research provides data supporting the use of qPCR for detection of MA, MI, and MAP in drinking water biofilm; an important tool that can increase our understanding of the ecology of these opportunistic pathogens and advance efforts to control them.

METHODS

QPCR assay development

MA- and MI-specific primers and probes were designed from an alignment of 16S rDNA sequences (>1,300 bp) including four MA strains (GenBank Accession numbers AJ536037, X52934, NR_102855.1, M61672.1), seven MI strains (AJ536036, GQ153276.1, X529271.1, X88916, X88919, X88920, X88921), 19 non-MAC Mycobacterium species (X52923, X55589, X55603, AF480598, AF058712, X52932, AF480601, X52930, M29571, AF480603, X55594, U92090, EU379247, HM011256, U57632, U84502, X82459, AY208857, DQ536403.2), and Nocardia abscessus (AF430018) using Lasergene (DNASTAR, Madison, WI) and Primer Express (Applied Biosystems, Foster City, CA). The MA assay was designed to detect all subspecies of M. avium. Primers and probes were evaluated in silico for specificity using the PrimerBlast tool at NCBI (www.ncbi.nlm.nih.gov) prior to in vitro testing (Ye et al. 2012). The final MA and MI qPCR assays utilize the same forward primer and probe, but MA- and MI-specific reverse primers differed by 6 bp (Table 1).

Table 1

Real-time PCR assays for detection of MA, MI, and MAP

Target Sequence (5′ to 3′) Product size (bp) Calibration model parameter Coefficient of determination, R2 Amplification efficiencya Reference 
M. avium (16S rRNA) F: GGGTGAGTAACACGTGTGCAA; R: CCAGAAGACATGCGTCGTGA; P: TGCACTTCGGGATAAGCCTGGGAAA 97 Y = −3.01x + 40.6 0.97 1.1 This study 
MI (16S rRNA) F: GGGTGAGTAACACGTGTGCAA; R: CCACCTAAAGACATGCGACTAAA; P: TGCACTTCGGGATAAGCCTGGGAAA 100 Y = −3.05x + 38.6 0.98 1.1 This study 
MAP (IS900F: CCGCTAATTGAGAGATGCGATTGG; R: ATTCAACTCCAGCAGCGCGGCCTCG; P: TCCACGCCCGCCCAGACAGG 230    Kim et al. (2002)  
MAP (Target 251) F: GCAAGACGTTCATGGGAA; R: GCGTAACTCAGCGAACAACA; P: CTGACTTCACGATGCGGTTCTTC 200    Rajeev et al. (2005)  
Target Sequence (5′ to 3′) Product size (bp) Calibration model parameter Coefficient of determination, R2 Amplification efficiencya Reference 
M. avium (16S rRNA) F: GGGTGAGTAACACGTGTGCAA; R: CCAGAAGACATGCGTCGTGA; P: TGCACTTCGGGATAAGCCTGGGAAA 97 Y = −3.01x + 40.6 0.97 1.1 This study 
MI (16S rRNA) F: GGGTGAGTAACACGTGTGCAA; R: CCACCTAAAGACATGCGACTAAA; P: TGCACTTCGGGATAAGCCTGGGAAA 100 Y = −3.05x + 38.6 0.98 1.1 This study 
MAP (IS900F: CCGCTAATTGAGAGATGCGATTGG; R: ATTCAACTCCAGCAGCGCGGCCTCG; P: TCCACGCCCGCCCAGACAGG 230    Kim et al. (2002)  
MAP (Target 251) F: GCAAGACGTTCATGGGAA; R: GCGTAACTCAGCGAACAACA; P: CTGACTTCACGATGCGGTTCTTC 200    Rajeev et al. (2005)  

F: forward primer; R: reverse primer; P: probe (5′-FAM and 3′-TAMRA).

Specificity and sensitivity analyses

Eighteen non-MAC Mycobacterium reference strains, and 76 MA and 17 MI isolates obtained from humans and environmental sources were used to test specificity and sensitivity of the MA and MI qPCR assays (Tables 2, 3(a) and 3(b)). Reference strains were obtained from ATCC, Los Angeles County Hospital, and the Centers for Disease Control and Prevention. Human and environmental MAC isolates were described previously (Aronson et al. 1999; Yoder et al. 1999). Strains were grown on Middlebrook 7H10 agar supplemented with oleic albumin dextrose catalase (OADC) enrichment (Becton-Dickinson, Germany) and incubated at 37 °C for a minimum of 2 weeks prior to DNA extraction using the Wizard® Genomic DNA Purification Kit (Promega Corporation, Madison, WI.).

Table 2

List of non-MAC strains used in specificity analysis

Non-MAC isolates ATCC No. 
M. septicum 700,731 
M. parvum 49,939 
M. abscessus a 
M. abscessus a 
M. abscessus a 
M. abscessus a 
M. peregrinum a 
Nocardia cyriacigeorgica a 
M. chelonae 19,977 
M. bovis 35,743 
M. kansasii 12,478 
M. fortuitum 6841 
M. fortuitum 6842 
M. fortuitum a 
M. senegalense 35,796 
M. margentense 700,351 
M. gordonei a 
M. simiae 25,275 
Non-MAC isolates ATCC No. 
M. septicum 700,731 
M. parvum 49,939 
M. abscessus a 
M. abscessus a 
M. abscessus a 
M. abscessus a 
M. peregrinum a 
Nocardia cyriacigeorgica a 
M. chelonae 19,977 
M. bovis 35,743 
M. kansasii 12,478 
M. fortuitum 6841 
M. fortuitum 6842 
M. fortuitum a 
M. senegalense 35,796 
M. margentense 700,351 
M. gordonei a 
M. simiae 25,275 

aIsolates donated by CDC, Los Angeles County Hospital.

Table 3

(a) Mean Cq of M. avium isolates analyzed by M. avium and MI qPCR assays

MA isolate ID MA mean Cq MI mean Cq MA isolate ID MA mean Cq MI mean Cq 
D41CO1 20.26 – D20BNIN 21.14 – 
D10CN4W 21.93 – DIDCC5 16.31 – 
CA3 20.34 – H08FC8N 20.47 – 
W292 20.20 – H14FC8N 18.14 – 
H10B01 20.66 – H13AC8p 20.45 – 
D20DN8N 20.85 – H01B01 20.05 – 
W209 19.05 – H08FC8N 27.08 – 
B07B01 23.57 – H07AC8N 17.58 – 
H13AC8P 20.79 – H05DN5 20.63 – 
CA2 21.87 – D55AC8N 19.47 – 
H07AC8N 21.02 – D20DN8N 24.23 – 
H05BN5 23.24 – D20CO5N 19.40 – 
W290 19.81 – D10CC5tlsp 21.37 – 
CA7 19.42 – CW5 20.20 – 
W289 19.74 – D41EC8N 18.65 – 
W205 20.29 – D41BC8N 18.06 – 
W274 19.18 – D41E08N 18.59 – 
H13AC8P 20.70 – D55A01 19.12 – 
H14FC8N 18.68 – F86 17.59 – 
D20DN8N 19.87 – CA7 19.34 – 
H14FC8N 20.53 – W354 19.26 – 
W291 22.64 – CA2 25.54 – 
Bla 19.26 – CA3 25.20 – 
W347 18.28 – CW68 17.55 – 
W351 19.76 – W359 17.82 – 
H08AC8N 19.28 – W352-1 19.90 – 
CA4 19.36 – F72B 19.67 – 
CA5 20.10 – W348 22.26 – 
W46 20.45 – W317 22.77 – 
W88 28.23 – W129 19.05 – 
F72C 21.79 – W125 19.06 – 
F100 17.51 – W80 20.30 – 
H05BN5be 20.02 – W41 18.99 – 
F72b 19.93 – W17 20.02 – 
F103B 21.54 – W10 18.22 – 
CW4 19.64 – CW26 23.25 – 
W359 23.77 – CW12 17.76 – 
F7A 20.04 – CW36 19.88 – 
MA isolate ID MA mean Cq MI mean Cq MA isolate ID MA mean Cq MI mean Cq 
D41CO1 20.26 – D20BNIN 21.14 – 
D10CN4W 21.93 – DIDCC5 16.31 – 
CA3 20.34 – H08FC8N 20.47 – 
W292 20.20 – H14FC8N 18.14 – 
H10B01 20.66 – H13AC8p 20.45 – 
D20DN8N 20.85 – H01B01 20.05 – 
W209 19.05 – H08FC8N 27.08 – 
B07B01 23.57 – H07AC8N 17.58 – 
H13AC8P 20.79 – H05DN5 20.63 – 
CA2 21.87 – D55AC8N 19.47 – 
H07AC8N 21.02 – D20DN8N 24.23 – 
H05BN5 23.24 – D20CO5N 19.40 – 
W290 19.81 – D10CC5tlsp 21.37 – 
CA7 19.42 – CW5 20.20 – 
W289 19.74 – D41EC8N 18.65 – 
W205 20.29 – D41BC8N 18.06 – 
W274 19.18 – D41E08N 18.59 – 
H13AC8P 20.70 – D55A01 19.12 – 
H14FC8N 18.68 – F86 17.59 – 
D20DN8N 19.87 – CA7 19.34 – 
H14FC8N 20.53 – W354 19.26 – 
W291 22.64 – CA2 25.54 – 
Bla 19.26 – CA3 25.20 – 
W347 18.28 – CW68 17.55 – 
W351 19.76 – W359 17.82 – 
H08AC8N 19.28 – W352-1 19.90 – 
CA4 19.36 – F72B 19.67 – 
CA5 20.10 – W348 22.26 – 
W46 20.45 – W317 22.77 – 
W88 28.23 – W129 19.05 – 
F72C 21.79 – W125 19.06 – 
F100 17.51 – W80 20.30 – 
H05BN5be 20.02 – W41 18.99 – 
F72b 19.93 – W17 20.02 – 
F103B 21.54 – W10 18.22 – 
CW4 19.64 – CW26 23.25 – 
W359 23.77 – CW12 17.76 – 
F7A 20.04 – CW36 19.88 – 
Table 3

(b) Mean Cq of MI isolates analyzed by M. avium and MI qPCR assays

MI isolate ID MA mean Cq MI mean Cq MI isolate ID MA mean Cq MI mean Cq 
D09FCLC – 16.63 H15DC8N – 16.33 
H07EN81 – 34.90 D01ACFB – 16.16 
H03AN5st – 22.42 D09FCLC – 16.46 
W173 – 15.92 H15CC1 – 15.88 
CW6-8 – 17.23 D09CC5be – 18.51 
W2 – 17.53 H03AC8a – 39.75 
R10N6 – 17.71 D01AC5 – 32.87 
B03CC8N – 18.76 B07FC5N – 36.80 
D09F03beap – 18.88    
MI isolate ID MA mean Cq MI mean Cq MI isolate ID MA mean Cq MI mean Cq 
D09FCLC – 16.63 H15DC8N – 16.33 
H07EN81 – 34.90 D01ACFB – 16.16 
H03AN5st – 22.42 D09FCLC – 16.46 
W173 – 15.92 H15CC1 – 15.88 
CW6-8 – 17.23 D09CC5be – 18.51 
W2 – 17.53 H03AC8a – 39.75 
R10N6 – 17.71 D01AC5 – 32.87 
B03CC8N – 18.76 B07FC5N – 36.80 
D09F03beap – 18.88    

Analytical sensitivity was evaluated using reference strains MA ATCC 76102 and MI ATCC 13950. Strains were propagated in 20 mL Middlebrook 7H9 broth containing albumin dextrose catalase (ADC) and 2 mg·L−1 mycobactin J (Allied Monitor, Fayette, MO), pelleted and washed three times with sterile phosphate-buffered saline (PBS) pH 7.0, and resuspended in 5 mL sterile PBS. The concentration of cells was determined in triplicate by enumerating colonies obtained from spread plating serial dilutions on Middlebrook 7H10 agar supplemented with OADC and mycobactin J. Analytical sensitivity, defined as the lowest approximate number of M. avium and MI cells per sample that could be detected 100% of the time by qPCR (Beumer et al. 2010), was determined by spiking 10-fold serial dilutions of cells from frozen cell stocks ranging from 103 to a theoretical single cell onto five sterile swabs which were processed identically to biofilm samples.

Sample collection

Biofilm samples were collected from kitchen faucets in 51 different homes in the midwest region of the United States from June through August, 2010. Residents of homes providing samples in this study received water from one of five different public water systems that were either small (serving 500–3,300 people), large (serving 10,001–100,000 people), or very large (serving >100,000 people) systems. These systems used either groundwater, surface water, or a mixture of both as source water, and a variety of different treatments, but all five systems used chlorine as the primary disinfectant. Two sterile cotton swab samplers, each containing 10 mL Butterfield's phosphate buffer (Weber Scientific, Hamilton, NJ), were given to each resident. Residents swabbed the interior of their kitchen faucet, or the exterior surface of their faucet aerator if it could not be removed, first thing in the morning before faucets were used. Swabs were transported to the laboratory on ice and biofilm was resuspended by vortexing swabs for 2 min. The resulting biofilm slurry was immediately processed for protein estimation and DNA isolation (described below).

DNA isolation and protein analysis

DNA from biofilm was purified using a bead beating method described previously (Beumer et al. 2010). Briefly, 10 mL biofilm slurry was vacuum filtered through a 47.0 mm, 0.45 μm polycarbonate membrane (GE Water & Process Technologies, Trevose, PA) and the membrane transferred to a sterile 2 mL conical microcentrifuge tube containing 0.3 g of 0.1 mm glass beads (Biospec Products Inc., Bartlesville, OK). Microorganisms were lysed by adding 500 μL WaterMaster Lysis Solution (EpiCentre, Madison, WI) and bead-milled in a Mini-beadbeater (BioSpec Products Inc.) for 3 min. DNA was purified from the crude lysate using selected WaterMaster DNA Purification Kit reagents (Epicentre) and modified WaterMaster protocol (Beumer et al. 2010).

The size, shape, and construction materials of kitchen faucets are highly variable, as is the manner in which individuals swab them. To normalize for sample-to-sample variation, protein concentrations were determined using 100 μL aliquots of biofilm slurry and the Micro BCA™ Protein Assay Kit (Thermo Scientific, Inc., Rockford, IL) and a Spectramox M2 spectrophotometer (absorbance = 562 nm; Molecular Devices, Sunnyvale, CA). Estimates of mycobacteria were normalized to amount of protein (μg) in each sample.

Amplification by qPCR

The TaqMan Exogenous internal positive control (IPC) (Applied Biosystems) was included to detect inhibition. Amplification was performed using 5 μL DNA extract, 12.5 μL TaqMan Environmental Master Mix 2.0 (Applied Biosystems, Foster City, CA), 2.5 μL Exogenous IPC mix, 0.5 μL Exogenous IPC DNA, 1.0 μL 0.5 mg·mL−1 bovine serum albumin, 900 nM each primer, and 200 nM probe in a total volume of 25 μL. All reactions were carried out in an ABI Model 7900 HT sequence detection system (Applied Biosystems, Foster City, CA) in triplicate. Thermocycler conditions consisted of 50 °C for 2 min, 95 °C for 10 min, 40 cycles of 95 °C for 15 sec, and 60 °C for 1 min. Data were analyzed with cycle quantification (Cq) threshold set at 0.15.

Standards and controls

Five milliliters of biofilm sample was spiked with approximately 103M. avium ATCC 76102, MI ATCC 13950, and MAP ATCC 49164 cells and processed in a similar way to non-spiked samples to determine the recovery efficiency of the method. Standard curves, filter blanks, sterile swabs, no template controls and IPCs were run alongside all samples. Master standard curves were generated for each assay from six independent sets of serially diluted purified genomic DNA from MA, MI, and MAP ranging from approximately 1 to 105 target copies analyzed in triplicate. Absolute quantification from master standard curves was performed to estimate MA, MI 16S rRNA and MAP IS900 target copies in each biofilm sample (Sivaganesan et al. 2010).

Biofilm samples positive for the MAP-specific IS900 qPCR assay were also analyzed with the Target 251 qPCR assay in duplicate as a presence/absence confirmation assay. IS900 is a common target used to identify MAP and has an average of 14–18 copies per genome. Target 251 corresponds to a portion of the MAP-specific 2765c gene which has one copy per genome (Kim et al. 2002; David Alexander, personal communication). Only samples positive for both assays were considered positive for MAP.

Data analyses

Concentration estimates were calculated as mean target copies μg−1 of protein. Associations in the concentrations of protein and MA, MI, and MAP target copies were evaluated using Pearson's correlation test. A one-way ANOVA was used to determine if protein or target copy concentrations were influenced by sampling inside or outside the kitchen faucet grate or by location of sample sites to water treatment facilities. Statistical analyses were performed using SPSS, version 16 (SPSS, Inc., Chicago, IL).

RESULTS

Specificity and sensitivity analyses

Experimental analysis of the MA and MI qPCR assays with 18 non-MAC strains confirmed that both assays were 100% specific. Furthermore, 17 MI isolates correctly tested negative with the MA qPCR assay and 76 MA isolates correctly tested negative with the MI qPCR assay (Tables 2, 3(a) and 3(b)). Sensitivity analysis of the qPCR assays on DNA extracts from 76 MA and 17 MI culture isolates showed that both the MA and MI assays were 100% sensitive. Evaluation of the analytical sensitivity indicated that the MA and MI qPCR assays were able to detect dilutions containing theoretically 1,000 cells spiked on a sampling swab 100% (5/5) of the time. When >100 cells were spiked onto the sampling swab, MA and MI were detected 93 and 74% of the time, respectively. The specificity and sensitivity of MAP IS900 and Target 251 qPCR assays were previously evaluated (Kim et al. 2002; Rajeev et al. 2005; Beumer et al. 2010).

Biofilm samples spiked with MA, MI, and MAP cells showed no inhibition (Cq values were ±2.5 standard deviations of the means of the Cq values of the corresponding control samples) and all method blanks (n = 96) and no template controls were negative. Cq values from IPC and spike analyses indicated that inhibition or interference did not impact the efficiency of DNA recovery or amplification. None of the spiked biofilm samples had Cq values outside the acceptable range.

Occurrence in biofilm samples

MA, MI, and MAP (IS900 assay) genetic targets were found in 35.3, 56.9, and 47.1% of the drinking water biofilm samples analyzed (Figure 1). Target copy estimates ranged from 15 to 11,959 copies μg−1 protein, 2 to 15,626 copies μg−1 protein, and 5 to 12,621 copies μg−1 protein, respectively. Of the 21 samples positive with the MAP IS900 assay, only six (11.8%) were confirmed positive with the Target 251 assay. Protein concentrations ranged from 3.3 to 39.5 μg protein mL−1 of biofilm sample. No significant associations between the levels of protein and estimates of MI or MAP target copies in biofilm samples were observed. However, protein concentrations were found to be positively associated with MA target copy estimates (r = 0.57; p < 0.05). No significant differences were detected between the location of sample collection (interior of faucet or exterior surface of aerator) with the occurrence of MA or MI target copies or protein concentrations except with MAP where higher target copy estimates were detected inside the faucet compared to the exterior surface (p < 0.05).

Figure 1

Mean log10 estimates of MA, MI, and IS900 MAP target copies (bars) and percent positive (crosses) in kitchen faucet biofilm samples analyzed. The proportion of samples positive for the MAP confirmatory Target 251 qPCR assay was 11.8% and is not shown.

Figure 1

Mean log10 estimates of MA, MI, and IS900 MAP target copies (bars) and percent positive (crosses) in kitchen faucet biofilm samples analyzed. The proportion of samples positive for the MAP confirmatory Target 251 qPCR assay was 11.8% and is not shown.

DISCUSSION

While MAP was detected in 47.1% of biofilm samples with the IS900 qPCR assay, only 11.8% of biofilm samples were confirmed positive with the Target 251 assay. The IS900 assay is more sensitive than the Target 251 assay, having a limit of detection (LOD) ten-fold lower than the LOD of the Target 251 assay (Beumer et al. 2010). This observation may be due to a difference in the number of IS900 and Target 251 gene copies in the MAP genome: there are an estimated 14 to 18 copies of IS900 and one copy of Target 251 per genome (Imirzalioglu et al. 2011). The qPCR products from biofilm samples testing positive by both IS900 and Target 251 assays contained single bands of the correct size (230 and 200 bp, respectively) by gel electrophoresis. Of the six biofilm samples confirmed positive for MAP by the Target 251 assay, only four were positive with the MA qPCR assay. Sampling variability associated with the low concentrations of Target 251 and 16S target sequences which both occur as single copies in the MA and MAP genomes, as well as differences in amplification efficiency, may explain the differences in detection.

MI occurred more frequently than MA in kitchen faucet biofilm samples (Figure 1). These findings support those of Falkinham et al. (2001) where MI was more frequently recovered from biofilm samples and MA from bulk water samples using a culture method. However, the total estimated concentration (mean log10 target copy number from all samples) of MA was greater than MI. Investigations on the diversity of opportunistic pathogens in biofilms from showerheads detected MA in 78% of biofilm samples by qPCR, but concentrations were not reported (Feazel et al. 2009). A recent finding by Wallace et al. (2013) suggests that the MI qPCR assay may be amplifying Mycobacterium chimaera; however, more studies may be needed to confirm its presence in these biofilm samples. Although the frequency of occurrence of MAP (IS900 qPCR assay) in biofilm samples reported by Beumer et al. (2010) was 6.4 times higher than in this study, target copy concentrations were similar: <100 target copies in 68 and 100% in the previous and current studies, respectively.

The qPCR assays described here are not the first to target mycobacteria. Torvinen et al. (2010) and Radomski et al. (2010) described genus-specific Mycobacterium qPCR assays targeting the 16S rDNA for estimating mycobacteria occurrence in surface water and household dust samples, respectively. QPCR assays have been developed to detect MA (Feazel et al. 2009) and other clinically relevant species of mycobacteria (Richardson et al. 2009) using 16S species-specific primers and SYBR Green detection. This approach may be sufficient for certain applications, such as identification of cultured isolates, but may be problematic for quantification from biofilm due to non-specific binding of SYBR Green to dsDNA and lack of sequence-specific probes. Restrepo et al. (2006) developed a qPCR assay targeting MA 16S rDNA for identification of this pathogen in paucibacillary disease. Specificity of the assay was evaluated on one clinical MA isolate. Leung et al. (2009) developed qPCR assays targeting MA and MI 16S rDNA using universal bacterial primers and MA or MI-specific probes for purposes of identifying Mycobacterium isolates in a high-throughput public health laboratory. In that study, approximately 8% of clinical MA isolates were positive with the MI assay and sensitivity of the assays on environmental samples was not evaluated. Since most mycobacteriosis is acquired from human exposure to contaminated drinking water and nearly 50% of hospitalizations in the USA are caused by MAC (Collier et al. 2012), accurate estimates of MA and MI occurrence in drinking water and biofilm is essential and necessitated development of new MA- and MI-specific qPCR assays for this purpose. As we obtain more genome sequence information from clinical and environmental isolates, we hope to improve these assays by incorporating additional unique targets for MA and MI to verify their detection in biofilm samples.

A major challenge of detecting and quantifying mycobacteria by culture in environmental samples, especially biofilm, is the rapid over-growth of non-target microorganisms that often prevent their isolation. Culturing of mycobacteria requires days to months to produce results. Interference and/or contamination by non-target microorganisms often occur resulting in frequent loss of samples. We attempted to culture MA and MI in this study, using the method described in Covert et al. (1999), to confirm our qPCR results (data not shown). However, due to the microbiological complexity of the kitchen tap biofilm, the majority of culture samples had to be discarded prior to the 8-week minimum incubation period because of overgrowth of non-target organisms. We recovered 113 isolates from biofilm, none of which were MA or MI by 16S rDNA and hsp65 sequence analysis. Rapid qPCR methods enable detection of even the most difficult-to-culture mycobacteria while avoiding sample loss. Results from this study demonstrate that qPCR analysis of mycobacteria from biofilm samples can be more easily performed without interference being a major limitation.

To date, little information is known about the occurrence of mycobacteria in drinking water biofilms or the abiotic and biotic factors that influence their ecology. Geographic distribution and proximity of sample sites to water treatment facilities were examined in this study but the limited sample size (n = 51) provided insufficient statistical power to determine significant trends. Falkinham et al. (2001) found mycobacteria more frequently in distribution system samples than at points farther from the treatment facility. For the majority of samples collected in this study, age of the kitchen plumbing was not known. At least three of the biofilm samples were from newly replaced faucets and MA, MI, and MAP were absent in those samples. Temperature or seasonal variability, treatment processes, nutrient levels in source water, and water flow in distribution systems have been found to contribute to the occurrence of mycobacteria in biofilm (Kubalek & Komenda 1995; Falkinham et al. 2001; Torvinen et al. 2007).

Although investigation of mycobacteria occurrence in the environment by qPCR has shown promise (Khan & Yadav 2004; Ravva & Stanker 2005; Feazel et al. 2009; Beumer et al. 2010; Radomski et al. 2010; Torvinen et al. 2010), a disadvantage of qPCR is its inability to distinguish between live and dead cells. Detection of live MAP cells with the use of qPCR coupled with propidium monoazide has been investigated although further research with MA and MI is needed (Kralik et al. 2010). Nevertheless, the advantages of qPCR for detection of mycobacteria are greater than the culture method: rapid time-to-results and minimal sample loss.

CONCLUSIONS

The use of qPCR for environmental mycobacteria detection enables quantification of difficult-to-culture mycobacteria, overcoming a major limitation of the culture method. To our knowledge, this is the first report on the use of MA and MI qPCR assays targeting 16S rRNA genes to investigate occurrence in biofilm samples from kitchen faucets, a site of human exposure to water and aerosols. Further research should be conducted to better understand the significance of qPCR-estimated concentrations of mycobacteria in biofilm, as well as the concentrations and mechanisms with which the organisms are transported from pipe-attached biofilm to drinking water. Information from this study supports the use of a rapid molecular method to better assess risk of exposure to mycobacteria in drinking water biofilm.

ACKNOWLEDGEMENTS

The authors wish to thank all individuals that provided samples for this study. The views expressed in this article are those of the authors and do not necessarily represent the views or policies of the US Environmental Protection Agency. Mention of trade names, products or services does not convey official EPA approval, endorsement, or recommendation. This project was supported in part by an appointment to the Research Participation Program for the US EPA, ORD, administered by the Oak Ridge Institute for Science and Education through an interagency agreement between the US DOE and the EPA.

REFERENCES

REFERENCES
Aronson
T.
Holtzman
A.
Glover
N.
Boian
M.
Froman
S.
Berlin
O. G.
Hill
H.
Stelma
G.
Jr.
1999
Comparison of large restriction fragments of Mycobacterium avium isolates recovered from AIDS and non-AIDS patients with those of isolates from potable water
.
J. Clin. Microbiol.
37
,
1008
1012
.
Beumer
A.
King
D.
Donohue
M.
Mistry
J.
Covert
T.
Pfaller
S.
2010
Detection of Mycobacterium avium subsp. paratuberculosis in drinking water and biofilms by quantitative PCR
.
Appl. Environ. Microbiol.
76
,
7367
7370
.
Cassidy
P. M.
Hedberg
K.
Saulson
A.
McNelly
E.
Winthrop
K. L.
2009
Nontuberculous mycobacterial disease prevalence and risk factors: a changing epidemiology
.
Clin. Infect. Dis.
49
,
e124
e129
.
Collier
S. A.
Stockman
L. J.
Hicks
L. A.
Garrison
L. E.
Zhou
F. J.
Beach
M. J.
2012
Direct healthcare costs of selected diseases primarily or partially transmitted by water
.
Epidemiol. Infect.
140
,
2003
2013
.
Covert
T. C.
Rodgers
M. R.
Reyes
A. L.
Stelma
G. N.
Jr.
1999
Occurrence of nontuberculous mycobacteria in environmental samples
.
Appl. Environ. Microbiol.
65
,
2492
2496
.
Falkinham
J. O.
III
,
1996
Epidemiology of infection by nontuberculous mycobacteria
.
Clin. Microbiol. Rev.
9
,
177
215
.
Falkinham
J. O.
III
,
2002
Nontuberculous mycobacteria in the environment
.
Clin. Chest Med.
23
,
529
551
.
Feazel
L. M.
Baumgartner
L. K.
Peterson
K. L.
Frank
D. N.
Harris
J. K.
Pace
N. R.
2009
Opportunistic pathogens enriched in showerhead biofilms
.
Proc. Natl. Acad. Sci. U S A
106
,
16393
16399
.
Griffith
D. E.
Aksamit
T.
Brown-Elliott
B. A.
Catanzaro
A.
Daley
C.
Gordin
F.
Holland
S. M.
Horsburgh
R.
Huitt
G.
Iademarco
M. F.
Iseman
M.
Olivier
K.
Ruoss
S.
von Reyn
C. F.
Wallace
R. J.
Jr.
Winthrop
K.
Subcommittee
A. T. S. M. D.
American Thoracic
S.
Infectious Disease Society of America
.
2007
An official ATS/IDSA statement: diagnosis, treatment, and prevention of nontuberculous mycobacterial diseases
.
Am. J. Respir. Crit. Care Med.
175
,
367
416
.
Kasperbauer
S. H.
Daley
C. L.
2008
Diagnosis and treatment of infections due to Mycobacterium avium complex
.
Semin. Respir. Crit. Care Med.
29
,
569
576
.
Radomski
N.
Lucas
F. S.
Moilleron
R.
Cambau
E.
Haenn
S.
Moulin
L.
2010
Development of a real-time qPCR method for detection and enumeration of Mycobacterium spp. in surface water
.
Appl. Environ. Microbiol.
76
,
7348
7351
.
Reed
C.
von Reyn
C. F.
Chamblee
S.
Ellerbrock
T. V.
Johnson
J. W.
Marsh
B. J.
Johnson
L. S.
Trenschel
R. J.
Horsburgh
C. R.
Jr.
2006
Environmental risk factors for infection with Mycobacterium avium complex
.
Am. J. Epidemiol.
164
,
32
40
.
Restrepo
B. I.
Gomez
D. I.
Shipley
G. L.
McCormick
J. B.
Fisher-Hoch
S. P.
2006
Selective enrichment and detection of mycobacterial DNA in paucibacillary specimens
.
J. Microbiol. Methods
67
,
220
229
.
Taylor
R. H.
Falkinham
J. O.
III
Norton
C. D.
LeChevallier
M. W.
2000
Chlorine, chloramine, chlorine dioxide, and ozone susceptibility of Mycobacterium avium
.
Appl. Environ. Microbiol.
66
,
1702
1705
.
Torvinen
E.
Torkko
P.
Rintala
A. N.
2010
Real-time PCR detection of environmental mycobacteria in house dust
.
J. Microbiol. Methods
82
,
78
84
.
US Environmental Protection Agency
2009
Method Validation of U.S. Environmental Protection Agency Microbiological Methods of Analysis.
FEM Document Number 2009-01. Washington, DC
.
Vaerewijck
M. J.
Huys
G.
Palomino
J. C.
Swings
J.
Portaels
F.
2005
Mycobacteria in drinking water distribution systems: ecology and significance for human health
.
FEMS Microbiol. Rev.
29
,
911
934
.
von Reyn
C. F.
Maslow
J. N.
Barber
T. W.
Falkinham
J. O.
III
Arbeit
R. D.
1994
Persistent colonisation of potable water as a source of Mycobacterium avium infection in AIDS
.
Lancet
343
,
1137
1141
.
Wallace
R. J.
Jr.
Iakhiaeva
E.
Williams
M. D.
Brown-Elliott
B. A.
Vasireddy
S.
Vasireddy
R.
Lande
L.
Peterson
D. D.
Sawicki
J.
Kwait
R.
Tichenor
W. S.
Turenne
C.
Falkinham
J. O.
III
2013
Absence of Mycobacterium intracellulare and presence of Mycobacterium chimaera in household water and biofilm samples of patients in the United States with Mycobacterium avium complex respiratory disease
.
J. Clin. Microbiol.
51
,
1747
1752
.
Ye
J.
Coulouris
G.
Zaretskaya
I.
Cutcutache
I.
Rozen
S.
Madden
T. L.
2012
Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction
.
BMC Bioinformatics
13
,
134
.
Yoder
S.
Argueta
C.
Holtzman
A.
Aronson
T.
Berlin
O. G.
Tomasek
P.
Glover
N.
Froman
S.
Stelma
G.
Jr.
1999
PCR comparison of Mycobacterium avium isolates obtained from patients and foods
.
Appl. Environ. Microbiol.
65
,
2650
2653
.