Abstract

The contamination of mussels and oysters by viruses and bacteria is often associated with water contamination and gastroenteritis in humans. The present study evaluated viral and bacterial contamination in 380 samples, from nine mollusk-producing regions in coastal water north of the Brazilian Amazon. Rotavirus contamination was studied for groups A to H, using a two-step SYBR Green RT-qPCR (quantitative reverse transcription polymerase chain reaction), and bacterial families Enterobacteriaceae, Vibrionaceae, and Aeromonadaceae by classical and molecular methods. From the 19 pools analyzed, 26.3% (5/19) were positive for group A Rotavirus, I2 genotype for VP6 region, without amplifications for groups B–H. Bacteriological analysis identified Escherichia coli isolates in 89.5% (17/19) with identification of atypical enteropathogenic E. coli aEPEC in 10.5% (2/19), Salmonella (Groups C1 and G) (10.5%, 2/19), Vibrio alginolyticus (57.9%, 11/19) V. parahaemolyticus (63.2%, 12/19), V. fluvialis (42.1%, 8/19), V. vulnificus (10.5%, 2/19), V. cholerae non-O1, non O139(10.5%, 2/19) and Aeromonas salmonicida (52.6%, 10/19). All the samples investigated presented some level of contamination by enterobacteria, rotavirus, or both, and these results may reflect the level of contamination in the Northern Amazon Region, due to the natural maintenance of some of these agents or by the proximity with human populations and their sewer.

INTRODUCTION

The marine environment is known as an important source of natural resources, which benefits mainly mollusk cultivation whose demands are fully satisfied. Increase in mollusk cultivation has favored their consumption, especially in coastal regions (Pereira et al. 2007).

These animals feed on particles and plankton during the process of water filtration which averages 4.8 L/h (Carver & Mallet 1990). However, because bivalve mollusks have this filtering behavior, they not only adsorb the nutrients they need but also retain and concentrate toxins, chemical pollutants, including heavy metals, found in water, as well as microorganisms present in the water following failures in the treatment of sewage (Pereira et al. 2007).

Many disease outbreaks associated with consumption of contaminated bivalve mollusk have been reported throughout the world, especially those related to consumption of raw or lightly cooked mollusks, such as oysters or mussels contaminated with norovirus, hepatitis A, poliovirus, and adenovirus (Fong & Lipp 2005; Westrell et al. 2010). Other viral agents such as hepatitis E virus and rotavirus (RV) have also been associated with outbreaks (Renou et al. 2008). These viruses are excreted in large numbers during infections in human beings, with around 100 billion viral particles per gram of feces, and the fact that they are stable in the environment, combined with a low infectious dose, facilitates the environmental contamination and dissemination of these pathogens in filter feeding animals (Fong & Lipp 2005).

Among these agents, the rotaviruses have great epidemiological importance. Rotaviruses belong to the Reoviridae family and have a genome formed by double-stranded RNA divided into 11 segments which codify 6 nonstructural proteins (NSP–NSP6) and 6 structural proteins (VP1-VP4, VP6, and VP7). Currently, there are eight groups classified as A–H; groups A, B, C and H stand out because they infect human beings and animals (Matthijnssens et al. 2012).

Bacterial contaminants are also of great interest for case reports of diarrhea associated with consumption of mollusks. According to Feldhusen (2000), there are three groups of pathogenic bacteria, associated with diseases caused by ingestion of bivalve mollusks and other marine products, divided according to their source of contamination: bacteria naturally present in the aquatic ecosystem (Aeromonashydrophila, Clostridium botulinum, Vibrio parahaemolyticus, V. cholerae, V. vulnificus and Listeriamonocytogenes); bacteria found in that environment as a result of contamination by animal feces (Salmonella spp., Shigella spp. and Escherichiacoli); and bacteria that contaminate products during manipulation and processing (Staphylococcus aureus).

Besides the indicators of fecal contamination, which are widely used to evaluate the microbiological quality of bivalve mollusks, different species of Vibrio occur naturally in marine, coastal, and estuarine environments, although some species, such as V.parahaemolyticus, V. vulnificus, and V.cholerae are potentially pathogenic for humans, and may be present in both raw and partially cooked fish and mollusks (Thompson et al. 2004). The occurrence of these bacteria is not related to counts of E. coli or thermotolerant coliforms but they are responsible for most gastroenteritis related to ingestion of seafood (Pereira et al. 2007).

Considering the increasing importance of shellfish consumption and production and the scarcity of studies in Amazonia, our objective was to evaluate the presence of these microorganisms in mussels and oysters from nine mollusk-producing regions located in the Brazilian Amazon.

MATERIALS AND METHODS

Sample collection and analyses

The samples in the study were collected from nine localities where bivalve mollusks are cultivated (Augusto Corrêa, Bragança, Curuçá, Maracanã, Marapanim, Primavera, Salinópolis, São Caetano de Odivelas and Tracuateua) (Figure 1). From each locality, an average of 19 pooled samples were collected, with 20 oysters each. The mollusks were opened under aseptic conditions, removing the soft part using scalpels and sterile tweezers and placed in sterile Petri dishes.

Figure 1

Location of the oyster-producing regions.

Figure 1

Location of the oyster-producing regions.

Processing

The samples were washed individually with sterile distilled water and alcohol at 70%. The valves were opened with scalpels under sterile conditions in a laminar flow cabinet. After removing the soft parts from a pool of mollusks, the tissue was triturated using a pestle and mortar. The necessary amount of material for bacteriological analyses (25 to 75 g) was obtained.

Viral analysis

Detection of rotavirus

The viral genome isolation was obtained from the digestive tissue using the silica method (Boom et al. 1990). To identify the virus, real-time PCR (polymerase chain reaction) was employed using the relative fluorescent quantification method SYBR Green with specific indicators (primers), for groups A–H that flank the same target region used in the PCR for regions VP6 and VP7 (Table 1).

Table 1

Sequence of primers for VP6 and VP7 genes

Primer Sequence 5′–3′ Target gene Amplicon bp 
RAVP6HUCOW-F ATC GGC AAG TAC GGA TTC AC VP6 122 
RAVP6HUCOW-R CGC TGG TGT CAT ATT TGG TG 122 
RBVP7HUM-F GGC AAT AAA ATG GCT TCA TTG C VP7 814 
RBVP7HUM-R CTA GCC GAA GCT GTA AAA ACC C 814 
RCVP6HUCOWPO-F CTG GCG CTC CAA ATG TTA AT VP6 502 
RCVP6HUCOWPO-R ACC ATT CTC TTC ACG GAT GC 502 
RDVP6CHIC2-F TGG ACT TTT GAT TTG CCA CA VP6 560 
RDVP6CHIC2-R TGT GTG GCA GCT TGA TTT CT 560 
RFVP6CHIC2-F TGG AGT TGC ACC ACT TTA CG VP6 583 
RFVP6CHIC2-R CGT GAA GCG AGT CAG TGG TA 583 
RGVP6CHIC-F CTC CAA CCT AGC TTT CAG CA VP6 846 
RGVP6CHIC-R TGG AAT GTT CCG GAT CCA CC 846 
RHVP6POR1-F GAA TGT ATA ATC TGC GGG ATC CA VP6 1,027 
RHVP6POR1-R TTA AAC ATG CAA TTT TCC TTG ACC 1,027 
Primer Sequence 5′–3′ Target gene Amplicon bp 
RAVP6HUCOW-F ATC GGC AAG TAC GGA TTC AC VP6 122 
RAVP6HUCOW-R CGC TGG TGT CAT ATT TGG TG 122 
RBVP7HUM-F GGC AAT AAA ATG GCT TCA TTG C VP7 814 
RBVP7HUM-R CTA GCC GAA GCT GTA AAA ACC C 814 
RCVP6HUCOWPO-F CTG GCG CTC CAA ATG TTA AT VP6 502 
RCVP6HUCOWPO-R ACC ATT CTC TTC ACG GAT GC 502 
RDVP6CHIC2-F TGG ACT TTT GAT TTG CCA CA VP6 560 
RDVP6CHIC2-R TGT GTG GCA GCT TGA TTT CT 560 
RFVP6CHIC2-F TGG AGT TGC ACC ACT TTA CG VP6 583 
RFVP6CHIC2-R CGT GAA GCG AGT CAG TGG TA 583 
RGVP6CHIC-F CTC CAA CCT AGC TTT CAG CA VP6 846 
RGVP6CHIC-R TGG AAT GTT CCG GAT CCA CC 846 
RHVP6POR1-F GAA TGT ATA ATC TGC GGG ATC CA VP6 1,027 
RHVP6POR1-R TTA AAC ATG CAA TTT TCC TTG ACC 1,027 

The amplification was obtained by the relative quantification method SYBR Green, based on the binding of the fluorescent dye SYBR Green into the PCR product (PE Applied Biosystems, Warrington, UK). The reaction was developed in 25 μL volumes, composed of SYBR Green Universal PCR Master Mix containing: Buffer at 1x, magnesium chloride 5.5 mM, dNTP 300 mM, AmpErase UNG (1 U/μL) 0.5 U, AmpliTaq Gold DNA Polymerase (5 U/μL) 1.25 U, specific primers for each target gene, and cDNA at 30 ng/μL. Sample incubation occurred in a Real Time 7500 PCR System (Applied Biosystem, USA) programmed for 95 °C for 10 minutes and 40 cycles of 92 °C for 15 seconds and 60 °C for 1 minute. The amplification was analyzed according to its fluorescence threshold and the resulting melt curve was compared with a positive control. Samples were considered positive when they presented the cycle threshold (Ct) below 35, followed by the melt curve and comparison with what was observed in the SA11 positive control. All reactions were accompanied by negative controls without RNA.

Sequencing

The analyzed samples were sequenced for mutations screening, phylogenetic analysis, and construction of a sequence data base. Thereby, the direct sequencing was performed in the ABI Prism 3500 genetic analyzer (Applied Biosystems, Foster City, CA, USA) using kit ABI PRISM™ Big Dye Terminator Cycle Sequencing V 3.1 (Applied Biosystems, USA) and the same PCR primers.

Sequence analysis

The resulting sequencing data were analyzed by the BioEdit v 7.2.5 software to evaluate mutations. The tree of phylogenetic relationships was constructed using the MEGA V.6.0 program, with neighbor-joining model and bootstrap of 10,000.

Microbiological analyses

For enterobacteria identification, the biochemical characterization and isolation method was performed. About 25 g of macerate was added to 225 mL of buffered peptone water (BPW pH 7.0), homogenized, and incubated at 35 °C for 18 hours. For Salmonella detection 0.1 mL of the culture in BPW was inoculated in Rappaport-Vassiliadis (RV) broth and incubated at 42.2 °C for 18 hours. Another 0.1 mL aliquot of BPW was inoculated in EC broth and incubated at 35 °C for 18 hours for E.coli isolation. Next, the cultures from RV and EC broths were plated on selective medium and indicators: SS agar and MacConkey agar, respectively, using methods described by the American Public Health Association (APHA). Suspect Salmonella and E.coli were subcultured to triple sugar iron (TSI) agar test and identified biochemically. To detect vibrios, 75 g of the samples were diluted in APW 1% NaCl, APW 3% NaCl, and BPW, and further isolated in SS, MC, and TCBS media using method described in the US Food and Drug Administration Bacterial Analytical Manual (Kaysner & DePaola 2001). About 5 to 10 suspect colonies were plated using TSI and Kligler agar medium, followed by biochemical and serological identification.

Molecular detection of diarrheagenic E.coli

The E.coli samples that had been previously identified biochemically were cultivated in nutrient agar (Difco) at 35–37 °C for 18–24 hours. The reference strains used as positive control were E.coli: EPEC E2348/69 (genes eae and bfpA), EAEC O42 (gene aggR), ETEC H10407 (genes elt and est), EIEC EDL1284 (gene ipaH) and EHEC EDL931 (gene stx) and a negative control E.coli K12 DH5α. The diarrheagenic E.coli were classified according to the presence of these genes.

Extraction of bacterial DNA and selection of indicators

DNA extraction, followed the protocol of Baloda et al. (1995). Multiplex PCR follows the protocol developed by Aranda et al. (2007) with modifications (Table 2).

Table 2

Oligonucleotides used for multiplex PCR and respective amplicons

Primer Sequence 5′– 3′ Gene Amplicon bp Reference 
eae-1 CTGAACGGCGATTACGCGAA eae 917 Aranda et al. (2004)  
eae-2 CGAGACGATACGATCCAG 
BFP-1 AATGGTGCTTGCGCTTGCTGC bƒpA 326 Aranda et al. (2004)  
BFP-2 GCCGCTTTATCCAACCTGGTA 
aggRks-1 GTATACACAAAAGAAGGAAGC aggR 254 Toma et al. (2003)  
aggRksa-2 ACAGAATCGTCAGCATCAGC 
LT-f GGCGACAGATTATACCGTGC elt 450 Aranda et al. (2004)  
LT-r CGGTCTCTATATTCCCTGTT 
ST-f ATTTTTMTTTCTGATTTRTCTT est 190 Aranda et al. (2004)  
ST-r CACCCGGTACARGCAGGATT 
IpaH-1 GTTCCTTGACCGCCTTTCCGATACCGTC ipaH 600 Aranda et al. (2004)  
IpaH-2 GCCGGTCAGCCACCCTCTGAGAGTAC 
VTcom-u GAGCGAAATAATTTATATGTG stx1/ stx518 Toma et al. (2003)  
VTcom-d TGATGATGGCAATTCAGTAT 
Primer Sequence 5′– 3′ Gene Amplicon bp Reference 
eae-1 CTGAACGGCGATTACGCGAA eae 917 Aranda et al. (2004)  
eae-2 CGAGACGATACGATCCAG 
BFP-1 AATGGTGCTTGCGCTTGCTGC bƒpA 326 Aranda et al. (2004)  
BFP-2 GCCGCTTTATCCAACCTGGTA 
aggRks-1 GTATACACAAAAGAAGGAAGC aggR 254 Toma et al. (2003)  
aggRksa-2 ACAGAATCGTCAGCATCAGC 
LT-f GGCGACAGATTATACCGTGC elt 450 Aranda et al. (2004)  
LT-r CGGTCTCTATATTCCCTGTT 
ST-f ATTTTTMTTTCTGATTTRTCTT est 190 Aranda et al. (2004)  
ST-r CACCCGGTACARGCAGGATT 
IpaH-1 GTTCCTTGACCGCCTTTCCGATACCGTC ipaH 600 Aranda et al. (2004)  
IpaH-2 GCCGGTCAGCCACCCTCTGAGAGTAC 
VTcom-u GAGCGAAATAATTTATATGTG stx1/ stx518 Toma et al. (2003)  
VTcom-d TGATGATGGCAATTCAGTAT 

RESULTS

Rotavirus identification

From the 19 pools analyzed using the qPCR technique, 26% (5/19) were positive for group A rotavirus, with Ct between 28 and 32 (Figure 2) with melt curve corresponding to observed positive control SA11 (Figure 3), without observing amplifications for the other investigated groups (B–H) (Table 3). Next, for validation, the samples were re-amplified by RT-PCR (Figure 4) and sequenced. After sequencing the VP6 region, they were compared and aligned with a database obtained from Rotavirus Classification Working Group (RCWG) (http://rotac.regatools.be/). After analysis in a BioEdit v 7.2.5 program and MEGA V.6.0, we obtained a phylogenetic tree of the five samples isolated from the pools (OST 4, MEX 5, MEX 8 MEX 13 and OST 14) (Figure 5) where it was possible to observe that all samples grouped in one branch together with the I2 genotype samples for RVA VP6.

Table 3

Summarized data for all samples

Samplea Rotavirus group searches
 
Bacteriology analyses
 
ORIGINb 
Enterobacteriacea Vibrionacea Aeromonadaceae 
MEX 1 – – – – – – –  V. parahaemolyticus  
MEX 2 – – – – – – – E. coli (aEPEC) V. parahaemolyticus A. salmonicida 
MEX 3 – – – – – – – E. coli, Salmonella Group G V. parahaemolyticus A. salmonicida 
OST 4 – – – – – – E. coli V. parahaemolyticus A. salmonicida 
MEX 5 – – – – – –  V. alginolyticus A. salmonicida 
MEX 6 – – – – – – – E. coli V. parahaemolyticus
V. alginolyticus 
 
MEX 7 – – – – – – – E. coli V. parahaemolyticus
V. alginolyticus
V. fluvialis 
A. salmonicida 
MEX 8 – – – – – – E. coli V. parahaemolyticus
V. vulnificus
V. alginolyticus
V. fluvialis 
 
OST 9 – – – – – – – E. coli V. parahaemolyticus
V. alginolyticus
V. fluvialis 
A. salmonicida 
MEX 10 – – – – – – – E. coli V. alginolyticus
V. fluvialis 
 
MEX 11 – – – – – – – E. coli; Salmonella Group C1 V. parahaemolyticus
V. alginolyticus
V. fluvialis 
 
OST 12 – – – – – – – E. coli V. alginolyticus
V. fluvialis 
A. salmonicida 
MEX 13 – – – – – – E. coli (aEPEC) V. parahaemolyticus
V. alginolyticus
V. cholerae 
A. salmonicida 
OST 14 – – – – – – E. coli V. fluvialis  
MEX 15 – – – – – – – E. coli V. parahaemolyticus
V. alginolyticus
V. fluvialis
V. cholerae 
A. salmonicida 
MEX 16 – – – – – – – E. coli V. parahaemolyticus
V. alginolyticus 
A. salmonicida 
MEX 17 – – – – – – – E. coli   
MEX 18 – – – – – – – E. coli Vibrio vulnificus  
OST 19 – – – – – – – E. coli   
Samplea Rotavirus group searches
 
Bacteriology analyses
 
ORIGINb 
Enterobacteriacea Vibrionacea Aeromonadaceae 
MEX 1 – – – – – – –  V. parahaemolyticus  
MEX 2 – – – – – – – E. coli (aEPEC) V. parahaemolyticus A. salmonicida 
MEX 3 – – – – – – – E. coli, Salmonella Group G V. parahaemolyticus A. salmonicida 
OST 4 – – – – – – E. coli V. parahaemolyticus A. salmonicida 
MEX 5 – – – – – –  V. alginolyticus A. salmonicida 
MEX 6 – – – – – – – E. coli V. parahaemolyticus
V. alginolyticus 
 
MEX 7 – – – – – – – E. coli V. parahaemolyticus
V. alginolyticus
V. fluvialis 
A. salmonicida 
MEX 8 – – – – – – E. coli V. parahaemolyticus
V. vulnificus
V. alginolyticus
V. fluvialis 
 
OST 9 – – – – – – – E. coli V. parahaemolyticus
V. alginolyticus
V. fluvialis 
A. salmonicida 
MEX 10 – – – – – – – E. coli V. alginolyticus
V. fluvialis 
 
MEX 11 – – – – – – – E. coli; Salmonella Group C1 V. parahaemolyticus
V. alginolyticus
V. fluvialis 
 
OST 12 – – – – – – – E. coli V. alginolyticus
V. fluvialis 
A. salmonicida 
MEX 13 – – – – – – E. coli (aEPEC) V. parahaemolyticus
V. alginolyticus
V. cholerae 
A. salmonicida 
OST 14 – – – – – – E. coli V. fluvialis  
MEX 15 – – – – – – – E. coli V. parahaemolyticus
V. alginolyticus
V. fluvialis
V. cholerae 
A. salmonicida 
MEX 16 – – – – – – – E. coli V. parahaemolyticus
V. alginolyticus 
A. salmonicida 
MEX 17 – – – – – – – E. coli   
MEX 18 – – – – – – – E. coli Vibrio vulnificus  
OST 19 – – – – – – – E. coli   

aMEX (mussel), OST (oyster); bProducing regions: 1, Augusto Corrêa; 2, Bragança; 3, Curuçá; 4, Maracanã; 5, Marapanim; 6, Primavera; 7, Salinópolis; 8, São Caetano de Odivelas; 9, Tracuateua.

Figure 2

Ct interval observed from five positive samples for group A rotavirus, with Ct between 28 and 32. Only assays with Ct below 35 were considered positive.

Figure 2

Ct interval observed from five positive samples for group A rotavirus, with Ct between 28 and 32. Only assays with Ct below 35 were considered positive.

Figure 3

Melt curve: The qPCR assays demonstrated to be uniform with only one peak for a sample, generating products similar to the SA11 positive control, no amplification was observed in the negative controls.

Figure 3

Melt curve: The qPCR assays demonstrated to be uniform with only one peak for a sample, generating products similar to the SA11 positive control, no amplification was observed in the negative controls.

Figure 4

Agarose gel 2% amplification for VP6 gene, RVA with 122pb for samples MEX 4, MEX 5, 8 MEX, MEX 13 and MEX 14.

Figure 4

Agarose gel 2% amplification for VP6 gene, RVA with 122pb for samples MEX 4, MEX 5, 8 MEX, MEX 13 and MEX 14.

Figure 5

Phylogenetic analysis of the VP6 gene. Phylogenetic tree constructed from rotavirus VP6 gene sequences amplified from five pooled fecal samples. The scale bar is proportional to the phylogenetic distance.

Figure 5

Phylogenetic analysis of the VP6 gene. Phylogenetic tree constructed from rotavirus VP6 gene sequences amplified from five pooled fecal samples. The scale bar is proportional to the phylogenetic distance.

Isolation of bacterial pathogens

After bacteriological analyses for Enterobacteriaceae, E.coli isolates were observed in 90% (17/19) of the pools being analysed (12 pools of mussels and 5 pools of oysters), with the identification of a typical enteropathogenic E.coli aEPEC in two pools (MEX2 and MEX13) using multiplex PCR. Two of these pools (MEX3 and MEX11) were also positive for Salmonella isolates (Groups C1 and G). Additionally, V.alginolyticus (11/19), V.parahaemolyticus (12/19), V.fluvialis (8/19), V.vulnificus (2/19), two samples of V.cholerae non-O1, non-O139 and Aeromonassalmonicida (10/19) were also isolated (Table 3).

DISCUSSION

Rotaviruses identified

This study encompassed detection of rotavirus (groups A–H) in bivalve mollusks taken from nine producing regions in Northern Amazon region of Brazil. The results showed the presence of group A rotavirus in 26% (5/19) of the samples, while the other groups (B–H) were not detected, similar to Santiago et al. (2014), who showed the existence of rotavirus in samples collected from street markets in research carried out in the City of Mexico. The Santiago et al. (2014) study analyzed 30 oyster samples, 10 of which were positive for Group A rotavirus (33%), using RT-PCR technique, higher than the values observed by Kou et al. (2008) with rotavirus and norovirus detected in 21% (32/150) of the oyster samples, of which 3.3% (5/150) were positive for rotavirus, and 14% (21/150) for norovirus GII and 4% (6/150) for norovirus GI.

All groups of rotavirus were analyzed, but only rotavirus A was identified, possibly by its high rate of excretion (about 100 billion viral particles per gram of feces) and because it is the most frequent group in cases of diarrhea in humans (Matthijnssens et al. 2012). The results presented may reflect the contamination caused by human occupation near the points of collection and cultivation of mollusks, similar to the case described by Krog et al. (2014) showing that analysis of bivalves gives overview of the contamination in the environment investigated.

According to Lees (2000), a range of viruses has been identified in samples of bivalve mollusks, among them rotavirus. In this study, a new qPCR methodology was used to identify the presence of rotavirus (groups A–H) where RVA VP6 was efficient in identifying the presence of contamination in 26% (5/19) of the samples analyzed. After sequencing for validation of the methods, the samples were characterized as I2 according to analysis in RCWG (http://rotac.regatools.be/). Kou et al. (2008) found similar frequencies (21.33%) with the identification of human genotypes G1, G3, and G9. Kittigul et al. (2015) identified in bivalve mollusks genotypes G1, G3, G9, and G12, however, with lower frequency (8.0%). Genotype I2 can be observed in association with G6-P[13]-I2, G2/8–P[4]–I2, G8-P[4]-I2, G3-P[14]-I2, and G3-P[9]-I2 (Grazia et al. 2010; Bonica et al. 2015). Doan et al. (2015) showed a possible zoonotic potential. In our analyses we observed that after phylogenetic analysis the samples grouped with isolated strains of sheep, bovines, and humans showing that it is possible that contamination by RVA may have more than one source as described by Ghosh et al. (2015) who identified G6-P[13]-I2 from swine that shared origins with human strains.

Pathogenic bacteria identified

The analyzed samples showed the presence of other bacteria (V.alginolyticus, V.parahaemolyticus, V.fluvialis, V.vulnificus, E.coli, and Salmonella spp.). It is because the Amazon region has a propitious environment for the maintenance of these agents, such as water temperature, pH, salinity, and nutrient concentrations favorable to their development (DePaola et al. 2010).

In the present study, E.coli was observed in a high percentage of samples (90%, 17/19) were similar to results described by Papadopoulou et al. (2007), who observed 100% contamination by E.coli in samples of mussels.

Brands et al. (2005) showed that the most probable number (MPN) of fecal coliforms permitted is not an indicator of the absence of Salmonella. In addition, detection of Salmonella spp. in 25 g of bivalve mollusks make its commercialization for human consumption economically unfeasible. Also, to be taken into consideration is the epidemiological distribution of certain waterborne food diseases, such as V.cholerae, considered endemic in aquatic ecosystems of the Brazilian Amazon (Thompson et al. 2011) and that was responsible for the important cholera epidemic in 1991.

CONCLUSIONS

All samples showed some degree of contamination bacterial, viral, or both. Although the presence of bacterial agents such as V. alginolyticus, V. parahaemolyticus, V. fluvialis, V. vulnificus, E. coli, and Salmonella spp. is due to the Amazonian ecosystem being favorable for the maintenance of these agents, the observed presence of E. coli aEPEC, Salmonella (Groups C1 and G), and rotavirus group A (genotype I2), found in human diarrheal cases, suggest the contamination of the environment by human populations in mollusk-production areas.

ACKNOWLEDGEMENTS

We would like to acknowledge Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) by providing the scholarship to Barros, B. C. V., and Marinho, A. N. R. and Fundação Amazônia Paraense de Amparo à Pesquisa (FAPESPA) for funding (ICAAF166/2014).

CONFLICT OF INTEREST

No conflict of interest declared.

REFERENCES

REFERENCES
Aranda
K. R. S.
,
Fagundes-Neto
U.
&
Scaletsky
I. C. A.
2004
Evaluation of multiplex PCRs for diagnosis of infection with diarrheagenic Escherichia coli and Shigella spp
.
J. Clin. Microbiol.
42
(
12
),
5849
5853
.
Baloda
S. B.
,
Krovacek
K.
,
Ericsson
L.
,
Linne
T.
&
Mansson
I.
1995
Detection of aerolysin gene in Aeromonas strains isolated from drinking water, fish, and foods by polymerase chain reaction
.
Comp. Immunol. Microbiol. Infect. Dis.
18
,
17
26
.
Bonica
M. B.
,
Zeller
M.
,
Van Ranst
M.
,
Matthijnssens
J.
&
Heylen
E.
2015
Complete genome analysis of a rabbit rotavirus causing gastroenteritis in a human infant
.
Viruses
7
,
844
856
.
Boom
R.
,
Sol
C. J. A.
,
Salimans
M. M. M.
,
Jansen
C. L.
,
Wertheim-Van Dillen
P. M. E.
&
Van Der Noordaa
J.
1990
Rapid and simple method for purification of nucleic acids
.
J. Clin. Microbiol.
28
,
495
503
.
Brands
D. A.
,
Inman
A. E.
,
Gerba
C. P.
,
Mare
C. J.
,
Billington
S. J.
,
Saif
L. A.
,
Levine
J. F.
&
Joens
L. A.
2005
Prevalence of Salmonella spp. in oysters in the United States
.
Appl. Environ. Microbiol.
71
,
893
897
.
DePaola
A.
,
Jones
J. L.
,
Woods
J.
,
Burkhardt
W.
3rd.
,
Calci
K. R.
,
Krantz
J. A.
,
Bowers
J. C.
,
Kasturi
K.
,
Byars
R. H.
,
Jacobs
E.
,
Williams-Hill
D.
&
Nabe
K.
2010
Bacterial and viral pathogens in live oysters: 2007 United States market survey
.
Appl. Environ. Microbiol.
76
,
2754
2768
.
Ghosh
S.
,
Navarro
R.
,
Malik
Y. S.
,
Willingham
A. L.
&
Kobayashi
N.
2015
Whole genomic analysis of a porcine G6P [13] rotavirus strain
.
Vet. Microbiol.
180
,
286
298
.
Grazia
S.
,
Giammanco
G. M.
,
Potgieter
C. A.
,
Matthijnssens
J.
,
Bányai
K.
,
Platia
M. A.
,
Colomba
C.
&
Martella
V.
2010
Unusual assortment of segments in 2 rare human rotavirus genomes
.
Emerg. Infect. Dis.
16
(
5
),
859
862
.
Kaysner
C. A.
,
DePaola
A.
Jr
2001
Vibrio cholerae, V. parahaemolyticus, V. vulnificus, and other Vibrio spp
. In:
Compendium of Methods for the Microbiological Examination of Foods
(
Downes
F. P.
&
Ito
K.
, eds).
American Public Health Association
,
Washington, DC
, pp.
405
420
.
Kittigul
L.
,
Singhaboot
Y.
,
Chavalitshewinkoon-Petmitr
P.
,
Pombubpa
K.
&
Hirunpetcharat
C. A.
2015
A comparison of virus concentration methods for molecular detection and characterization of rotavirus in bivalve shellfish species
.
Food Microbiol.
46
,
161
167
.
Krog
J. S.
,
Larsen
L. E.
&
Schultz
A. C.
2014
Enteric porcine viruses in farmed shellfish in Denmark
.
Int. J. Food Microbiol.
186
,
105
109
.
Lees
D.
2000
Viruses and bivalve shellfish
.
Int. J. Food Microbiol.
59
,
81
116
.
Matthijnssens
J.
,
Otto
P. H.
,
Ciarlet
M.
,
Desselberger
U.
,
Van Ranst
M.
&
Johne
R.
2012
VP6 sequence-based cut-off values as a criterion for rotavirus species demarcation
.
Arch. Virol.
157
(
6
),
1177
1182
.
Papadopoulou
C.
,
Economou
E.
,
Zakas
G.
,
Salamoura
C.
,
Dontoro
U. C.
&
Apostolou
J.
2007
Microbiological and pathogenic contaminants of seafood in Greece
.
J. Food Qual.
30
,
28
42
.
Renou
C.
,
Moreau
X.
,
Pariente
A.
,
Cadranel
J. F.
,
Maringe
E.
,
Morin
T.
,
Causse
X.
,
Payen
J. L.
,
Izopet
J.
,
Nicand
E.
,
Bourlière
M.
,
Penaranda
G.
,
Hardwigsen
J.
,
Gerolami
R.
,
Péron
J. M.
&
Pavio
N.
,
ANGH France
.
2008
A national survey of acute hepatitis E in France
.
Aliment. Pharmacol. Ther.
27
,
1086
1093
.
Santiago
C. Q.
,
Salinas
C. V.
,
Bonifacio
I. N.
,
Romero
B. L. B.
&
Ramírez
E. I. Q.
2014
Rotavirus G2P [P] detection in fresh vegetables and oysters in Mexico City
.
J. Food Prot.
77
,
1953
1959
.
Thompson
C. C.
,
Marin
M. A.
,
Dias
G. M.
,
Dutilh
B. E.
,
Edwards
R. A.
,
Iida
T.
,
Thompson
F. L.
&
Vicente
A. C. P.
2011
Genome sequence of the human pathogen Vibrio cholerae Amazonia
.
J. Bacteriol.
193
,
5877
5878
.
Thompson
F. L.
,
Lida
T.
&
Swing
J.
2004
Biodiversity of vibrios
.
Microbiol. Mol. Biol. Rev.
68
,
403
431
.
Toma
C.
,
Lu
Y.
,
Higa
N.
,
Nakasone
N.
,
Chinen
I.
,
Baschkier
A.
,
Rivas
M.
&
Iwanaga
M.
2003
Multiplex PCR assay for identification of human diarrheagenic Escherichia coli
.
J. Clin. Microbiol.
41
(
6
),
2669
2671
.
Westrell
T.
,
Dusch
V.
,
Ethelberg
S.
,
Harris
J.
,
Hjertqvist
M.
,
Jourdan-da Silva
N.
,
Koller
A.
,
Lenglet
A.
,
Lisby
M.
&
Vold
L.
2010
Norovirus outbreaks linked to oyster consumption in the United Kingdom, Norway, France, Sweden and Denmark 2010
.
Euro Surveill.
15
,
8
11
.