Abstract

A survey for antibiotic-resistant (AR) Escherichia coli in wastewater was undertaken by collecting samples from primary clarifiers and secondary effluents from seven geographically dispersed US wastewater treatment plants (WWTPs). Samples were collected at each WWTP in cool and summer months and cultured using selective media. The resulting isolates were characterized for resistance to imipenem, ciprofloxacin, cefotaxime, and ceftazidime, presence of carbapenemase and extended-spectrum beta-lactamase (ESBL) genes, and phylogroups and sequence types (STs). In total, 322 AR E. coli isolates were identified, of which 65 were imipenem-resistant. Of the 65 carbapenem-resistant E. coli (CREC) isolates, 62% were positive for more than one and 31% were positive for two or more of carbapenemase and ESBL genes targeted. The most commonly detected carbapenemase gene was blaVIM (n = 36), followed by blaKPC (n = 2). A widespread dispersal of carbapenem-resistant STs and other clinically significant AR STs observed in the present study suggested the plausible release of these strains into the environment. The occurrence of CREC in wastewater is a potential concern because this matrix may serve as a reservoir for gene exchange and thereby increase the risk of AR bacteria (including CR) being disseminated into the environment and thence back to humans.

INTRODUCTION

Escherichia coli, a member of the family Enterobacteriaceae, is the predominant enterobacterial gut resident in humans and other mammals and is commonly used as an indicator of fecal pollution in source, drinking, and recreational waters (Elmund et al. 1999; Edberg et al. 2000; Odonkor & Ampofo 2013). Antibiotic resistance, including to extended-spectrum cephalosporins (ESCs) and carbapenems, is increasingly prevalent among Enterobacteriaceae. According to the Centers for Disease Control and Prevention (CDC), prior to 2002 less than 1% of E. coli clinical isolates were ESC-resistant or produced extended-spectrum β-lactamases (ESBLs), whereas in a recent report approximately 22% of clinical E. coli isolates were ESC-resistant (Weiner et al. 2016). Prior to 2010, reports of carbapenem-resistant Enterobacteriaceae (CRE) infections were uncommon in the USA; however, according to the CDC's National Healthcare Surveillance Network, the percentage of CRE isolates identified from hospital acquired infections ranged from 3.3 to 10.9%, depending on the site of infection (Weiner et al. 2016).

Historically, carbapenem antibiotics have been effective against multi-drug-resistant Gram-negative bacilli and a mainstay of therapy for infections due to such organisms. Carbapenem-resistant E. coli (CREC) is increasingly prevalent, mainly due to the emergence of novel carbapenemases. Currently, the three carbapenemases categorized as being most important are Klebsiella pneumoniae carbapenemase (KPC; Ambler class A), certain metalloenzymes (VIM, NDM; Ambler class B), and OXA-type enzymes (e.g., OXA-48; Ambler class D) (Nordmann et al. 2012). The associated carbapenemase genes are frequently found on mobile genetic elements and have the potential to spread to other Gram-negative bacteria (Nordmann et al. 2012).

Although CREC have been recognized primarily in health care settings, investigators at the US Environmental Protection Agency (EPA) proposed that antimicrobial resistance surveillance involving sewage isolates could be informative as to the occurrence and dissemination of specific clonal groups or sequence types within a given community or population (Boczek et al. 2007). wastewater treatment plants (WWTPs) typically use a multi-stage treatment approach, consisting of preliminary, primary, and secondary treatment with effluent disinfection. Primary treatment occurs when wastewater received by the treatment plant is collected into settling basins, where solids and grease are removed from the liquid portion using screens and gravity. Such processes are successful at removing approximately 60% of suspended solids from the wastewater. This primary effluent is then subjected to some type of secondary treatment, typically involving biological treatment to further breakdown the organic material in the wastewater. Following secondary treatment, the effluent is disinfected either with a chemical oxidizing agent, such as chlorine, or a physical treatment such as exposure to UV radiation (Manual of Practice 8; Design of Wastewater Treatment Plants 1998; Boczek et al. 2010).

This study is follow-on research to preliminarily survey wastewater, specifically primary and secondary effluents, from seven locations in the USA for antibiotic-resistant (AR) E. coli to ESCs and carbapenem, to characterize the resulting isolates for the presence of carbapenemase and ESBL genes and identify sequence types that have been associated with extraintestinal infections in humans.

MATERIALS AND METHODS

Study sites, sample collection and titer determination

Seven geographically dispersed WWTPs in the continental US were selected opportunistically for sampling. Permission was granted by WWTP operators on the condition of plant anonymity. The WWTPs were located in New Jersey, Maryland, Ohio, Texas, Colorado, northern California, and southern California, and served four urban and three rural/suburban areas. All participating plants used conventional activated sludge for secondary treatment of primary clarified effluents.

Samples were collected at each WWTP once during cooler months (November 2012 or April 2013) and once during the summer (July 2013 or August 2013), for a total of 28 samples, four per WWTP. Each sample consisted of either 1 liter from the primary clarifier effluent or an effluent from secondary treatment after disinfection. The samples were collected in sterile polypropylene bottles, shipped overnight on ice to the US EPA, Cincinnati, OH, and analyzed within 24 hours of collection.

E. coli titers were determined for all samples using membrane filtration method 9222 I (Standard Methods for the Examination of Water and Wastewater 2017). E. coli identification was confirmed using BBL Crystal Kits and Crystal Mind Software with the Autoreader (BD Bioscience, Sparks, MD). Confirmed E. coli isolates were then assigned a unique identification number and stored in 10% glycerol at −80 °C until further analysis.

Isolation of antibiotic-resistant E. coli and antimicrobial susceptibility testing

AR E. coli were isolated using a membrane filtration procedure, using mFC agar (Becton Dickinson, Franklin Lakes, NJ) supplemented with 1 mg/L imipenem, 4 mg/L ciprofloxacin, 4 mg/L cefotaxime, or 16 mg/L ceftazidime (Sigma-Aldrich, St. Louis, MO), reflecting the respective resistance breakpoints specified by the Clinical and Laboratory Standards Institute (CLSI 2012). Briefly, serial dilutions ranging from 10 mL to 0.01 mL of sample were filtered through 0.45 μm polycarbonate filters and transferred to mFC plates supplemented with antibiotics and incubated at 44.5 °C. Filters that contained countable colonies (<100) were transferred to mFC supplemented with 4-methylumbelliferyl-β-d-glucuronide (MUG) to obtain AR E. coli titers and isolates. All MUG positive isolates were chosen for testing.

The four antibiotics were selected because of the 2015 Centers for Disease Control and Prevention's definition for CRE, i.e., full resistance to two third generation cephalosporins and intermediate to full resistance to a carbapenem. Ciprofloxacin was chosen to ensure coverage for the H30R subclone within STc131. This subclone is known for its characteristic resistance to ciprofloxacin and for causing most multi-drug-resistant E. coli infections in the USA (Johnson et al. 2010).

Minimum inhibitory concentrations (MICs) for ciprofloxacin, imipenem, ceftazidime, and cefotaxime were determined using E-Test™ Strips (bioMerieux, Marcy'Etoile, France). Isolates were classified as resistant, intermediate, or susceptible according to specified breakpoints (CLSI 2012). For data analysis, intermediate isolates were regarded as resistant.

Real-time PCR for carbapenemase and ESBL genes

CREC isolates were screened by real-time polymerase chain reaction (PCR) for four types of ESBL-encoding genes and five types of carbapanemase-encoding genes (Table 1). PCR was performed in a QuantStudio 6 Flex instrument (Applied Biosystems, Foster City, CA) as previously described (Ryu et al. 2012). Each PCR plate included controls to check for sample cross-contamination and positive controls. Dissociation curves were examined for evidence of potential primer-dimers and other non-specific reaction products.

Table 1

Sequence and reference information for qPCR analysis, with target genes, primer sequences, amplicon sizes, and annealing temperatures

Target gene Primer sequence (5′–3′) Amplicon size (bp) Annealing temperature References Control strains 
blaTEM TEM_F: AAGATGCTGAAGATCA; TEM_R: TTGGTATGGCTTCATTC 425 44 °C Speldooren et al. (1998)  E. coli T5 
blaSHV SHV_F: GCGAAAGCCAGCTGTCGGGC; SHV_R: GATTGGCGGCGCTGTTATCGC 304 62 °C Henriques et al. (2006a)  E. coli 52 
blaCTX-M CTX_F:58 SCVATGTGCAGYACCAGTAA; CTX_R: G55CTGCCGGTYTTATCVCC 652 55 °C Lu et al. (2010)  E. coli 85.01 
blaIMP IMP_F: GAATAGAGTGGCTTAATTGTC; IMP_R: GGTTTAAYAAAACAACCACC 232 55 °C Henriques et al. (2006b)  NTU 92/99 (IMP − 1) and P. aeruginosa 
blaVIM VIM_F: GATGGTGTTTGGTCGCATATCG; VIM_R: GCCACGTTCCCCGCAGACG 475 58 °C Henriques et al. (2006a)  P. putida 
blaKPC KPC_F: CATTCAAGGGCTTTCTTGCTGC; KPC_R: ACGACGGCATAGTCATTT 538 55 °C Dallenne et al. (2010)  E. coli USVAST − 0600 
blaGES GES_F: AGTCGGCTAGACCGGAAAG; GES_R: TTTGTCCGTGCTCAGGAT 399 57 °C Dallenne et al. (2010)  E. coli GES 
blaNDM NDM_F: GGGCAGTCGCTTCCAACGGT; NDM_R: GTAGTGCTCAGTGTCGGCAT 405 60 °C Manchanda et al. (2011)  E. coli MH01 
Target gene Primer sequence (5′–3′) Amplicon size (bp) Annealing temperature References Control strains 
blaTEM TEM_F: AAGATGCTGAAGATCA; TEM_R: TTGGTATGGCTTCATTC 425 44 °C Speldooren et al. (1998)  E. coli T5 
blaSHV SHV_F: GCGAAAGCCAGCTGTCGGGC; SHV_R: GATTGGCGGCGCTGTTATCGC 304 62 °C Henriques et al. (2006a)  E. coli 52 
blaCTX-M CTX_F:58 SCVATGTGCAGYACCAGTAA; CTX_R: G55CTGCCGGTYTTATCVCC 652 55 °C Lu et al. (2010)  E. coli 85.01 
blaIMP IMP_F: GAATAGAGTGGCTTAATTGTC; IMP_R: GGTTTAAYAAAACAACCACC 232 55 °C Henriques et al. (2006b)  NTU 92/99 (IMP − 1) and P. aeruginosa 
blaVIM VIM_F: GATGGTGTTTGGTCGCATATCG; VIM_R: GCCACGTTCCCCGCAGACG 475 58 °C Henriques et al. (2006a)  P. putida 
blaKPC KPC_F: CATTCAAGGGCTTTCTTGCTGC; KPC_R: ACGACGGCATAGTCATTT 538 55 °C Dallenne et al. (2010)  E. coli USVAST − 0600 
blaGES GES_F: AGTCGGCTAGACCGGAAAG; GES_R: TTTGTCCGTGCTCAGGAT 399 57 °C Dallenne et al. (2010)  E. coli GES 
blaNDM NDM_F: GGGCAGTCGCTTCCAACGGT; NDM_R: GTAGTGCTCAGTGTCGGCAT 405 60 °C Manchanda et al. (2011)  E. coli MH01 

Phylotyping and sequence typing

Phylogenetic groups of the AR E. coli isolates were defined by the quadraplex PCR method of Clermont et al. (2012). Clonal lineages were identified using 2-locus sequence analysis of fumC and fimH (CH typing) (Weissman et al. 2012). Each allele combination (i.e., CH type) was assigned to a putative sequence type (ST) based on the known association of CH types with STs (Weissman et al. 2012). In ambiguous situations, additional housekeeping gene loci were sequenced to clarify the most likely associated ST, according to Enterobase (http://enterobase.warwick.ac.uk).

RESULTS AND DISCUSSION

Titers of total E. coli, AR E. coli, and CREC were calculated for the WWTP samples to assess relative percentages of resistant organisms. Table 2 presents a summary of total E. coli titers along with the number of AR E. coli and CREC isolates obtained from each WWTP. Only results from the primary clarifiers are presented, as no AR E. coli isolates were obtained from the secondary effluents. Overall, 322 isolates were obtained that were resistant to ≥1 of the four antibiotics tested. Among the 322 AR E. coli isolates, the prevalence of resistance to individual agents declined sequentially as follows: cefotaxime (74%), ciprofloxacin (72%), ceftazidime (68%), and imipenem (20%). Additionally, 235 (73%) isolates qualified as multidrug-resistant, defined here as having resistance to ≥2 antibiotics tested. Notably, based on biochemical reactions, antibiotic resistance patterns, and sequence typing (results for the latter two are discussed below), and because no enrichment media were used, the AR isolates seemed unlikely to include replicates of the same clone from a given sample in the isolate collection.

Table 2

Summary of WWTP locations, Escherichia coli loads in primary clarifier effluents and antibiotic-resistant E. coli isolates obtained from each site

WWTP site Average facility capacity Dates of collection Total E. coli (CFU/100 mL) AR E. coli isolates CR E. coli isolates Raw wastewater composition 
Ohio 13 MGD July 2013 9.00 × 106 51 Domestic, urban 
Sept. 2013 2.70 × 106 
New Jersey 45 MGD July 2013 3.50 × 106 84 22 Domestic, urban 
Nov. 2012 4.50 × 106 
N. California 33 MGD July 2013 1.00 × 106 Agriculture, domestic, suburban 
April 2013 TNTC 
Texas 7.0 MGD July 2013 1.50 × 106 14 Agriculture, domestic, rural 
April 2013 2.00 × 107 
Maryland 5.0 MGD July 2013 3.00 × 107 32 Domestic, industrial, suburban 
April 2013 5.50 × 107 
Colorado 135 MGD July 2013 7.50 × 106 29 10 Agriculture, domestic, industrial, urban 
April 2013 3.00 × 107 
S. California 275 MGD July 2013 1.70 × 107 104 15 Industrial, agriculture, domestic, urban 
Sept. 2013 1.00 × 107 
WWTP site Average facility capacity Dates of collection Total E. coli (CFU/100 mL) AR E. coli isolates CR E. coli isolates Raw wastewater composition 
Ohio 13 MGD July 2013 9.00 × 106 51 Domestic, urban 
Sept. 2013 2.70 × 106 
New Jersey 45 MGD July 2013 3.50 × 106 84 22 Domestic, urban 
Nov. 2012 4.50 × 106 
N. California 33 MGD July 2013 1.00 × 106 Agriculture, domestic, suburban 
April 2013 TNTC 
Texas 7.0 MGD July 2013 1.50 × 106 14 Agriculture, domestic, rural 
April 2013 2.00 × 107 
Maryland 5.0 MGD July 2013 3.00 × 107 32 Domestic, industrial, suburban 
April 2013 5.50 × 107 
Colorado 135 MGD July 2013 7.50 × 106 29 10 Agriculture, domestic, industrial, urban 
April 2013 3.00 × 107 
S. California 275 MGD July 2013 1.70 × 107 104 15 Industrial, agriculture, domestic, urban 
Sept. 2013 1.00 × 107 

To estimate the overall prevalence of AR E. coli within the WWTP-associated E. coli population, colony counts for all 14 primary effluent samples were summed and an average was calculated for total E. coli and for E. coli resistant to imipenem, ciprofloxacin, cefotaxime, and ceftazidime. The average AR fraction within the total E. coli population, by agent, was 0.0022% for imipenem, 0.38% for cefotaxime, 0.031% for ceftazidime, and 3.1% for ciprofloxacin (Table S1, available with the online version of this paper). Comparable percentages were reported previously for raw wastewater from Poland, although no carbapenem-resistant organisms were found in that study (Łuczkiewwicz et al. 2010). It is difficult to compare the percentages of AR E. coli seen in wastewater to clinical studies, but percentages of CREC ranged from 0.7 to 1.9% in a survey of clinical infections, depending on the site of infection (Weiner et al. 2016). These higher carbapenem resistance percentages, as compared to the present findings in wastewater, would be expected because clinical settings will naturally concentrate AR isolates.

Antibiotic resistance in E. coli is more concerning when it occurs in strains capable of causing clinical infections, due to the potential for dissemination and the resulting morbidity and mortality. Phylogenetic analyses have shown consistently that most clinical E. coli isolates from human extraintestinal infections are derived from phylogroups B2 and D (Clermont et al. 2012). However, transfer of antibiotic resistance genetic elements from commensal to pathogenic strains is suspected to occur in reservoirs where these groups co-mingle, including WWTPs (Marshall et al. 2009; Bailey et al. 2010). Table 3 presents the phylotypes and associated resistance profiles of the present 322 AR E. coli isolates. Phylotypes B2 and D accounted collectively for nearly half (n = 181, 45%) of the sewage-source AR isolates (Table 3). Adding potentially pathogenic phylogroup F (Clermont et al. 2012) increased this to 56% of the total.

Table 3

Phylotyping of AR Escherichia coli with associated resistance profiles

Phylotype Number of isolates Imipenem Ciprofloxacin Cefotaxime Ceftazidime 
64 51 45 41 
B1 44 30 38 36 
B2 62 10 47 37 33 
30 12 27 25 25 
84 25 42 67 60 
35 32 25 23 
Totals 322 65 (20) 232 (72) 239 (74) 220 (68) 
Phylotype Number of isolates Imipenem Ciprofloxacin Cefotaxime Ceftazidime 
64 51 45 41 
B1 44 30 38 36 
B2 62 10 47 37 33 
30 12 27 25 25 
84 25 42 67 60 
35 32 25 23 
Totals 322 65 (20) 232 (72) 239 (74) 220 (68) 

Percentage of total number of isolates resistant to specific antibiotic in parentheses.

Overall, 65/322 (20%) isolates were imipenem-resistant. CREC (n = 65) were concentrated in virulence-associated phylogroups B2, D and F (38/181 (21%)), as compared with the other phylogroups combined (27/141 (19%)). By contrast, all phylogroups had a high prevalence of multi-resistant isolates, including resistance specifically to ciprofloxacin and ESCs. On a percentage basis, phylogroup C had the highest percentages of total AR E. coli.

The proportions of CRE per phylogroup are as follows (# CRE/# in phylogroup, %): A (6/64, 9%), B1 (9/44, 20%), B2 (10/62, 16%), C (12/30, 40%), D (25/84, 30%), and F (3/35, 9%). Thus, most CREC isolates (38/65 = 58%) were from phylogroups B2, D, or F and could represent extraintestinal pathogenic E. coli (ExPEC) which have an enhanced potential for causing disease in humans.

To further characterize the AR E. coli isolates, STs were determined to identify lineages associated with extraintestinal infections (Table 4). CH typing identified several ExPEC-associated clonal complexes (Johnson et al. 2010, 2017; Pitout 2012; Xia et al. 2017), namely (number of isolates, % of 322), STc131 (28, 8.7%), STc648 (17, 5.3%), ST1193 (25, 7.8%), and STc405 (12, 3.7%). Regarding the temporal and geographical distribution of these AR isolates from ExPEC-associated STs, carbapenem-resistant STc131 was identified in three separate samples from two locations (NJ, both summer and cooler temperatures; southern CA, summer only). Likewise, STc648 was identified in five locations, including two carbapenem-resistant isolates from two separate samples from one location (NJ, cooler and summer months); ST1193 was identified in five locations, including three CREC isolates from one sample in one location (NJ, summer); and STc405 was identified in five locations, including two CREC isolates from one sample in one location (MD, summer). These data indicate a widespread dispersal of these clinically significant AR STs with respect to locale and seasonality.

Table 4

Number of sequence types complexes found among AR E. coli known to be associated with clinically significant infections and their associated antibiotic resistance

Antibiotic resistance B2-ST131-O25b and B2-ST131-O16 D-STc 405 STc 648 ST 1193 
 (n = 28) (n = 12) (n = 18) (n = 27) 
Imipenem 4 (14) 2 (17) 2 (11) 3 (11) 
Ciprofloxacin 21 (75) 11 (92) 17 (94) 22 (81) 
Ceftazidime 15 (54) 9 (75) 9 (50) 10 (37) 
Cefotaxime 18 (64) 11 (92) 12 (67) 12 (44) 
Antibiotic resistance B2-ST131-O25b and B2-ST131-O16 D-STc 405 STc 648 ST 1193 
 (n = 28) (n = 12) (n = 18) (n = 27) 
Imipenem 4 (14) 2 (17) 2 (11) 3 (11) 
Ciprofloxacin 21 (75) 11 (92) 17 (94) 22 (81) 
Ceftazidime 15 (54) 9 (75) 9 (50) 10 (37) 
Cefotaxime 18 (64) 11 (92) 12 (67) 12 (44) 

Cell number represents number of isolates resistant to antibiotic, with percent in parentheses.

Determining the mechanisms that impart carbapenem resistance is imperative for epidemiological reasons. The major reason for carbapenem resistance is the presence of a carbapenemase-encoding gene. Many such genes are located on mobile genetic elements (Tait 1993), and tracking their dissemination can provide important information to health care professionals. Screening of our 65 CREC isolates by PCR for five carbapenemase genes and four ESBL genes (Table 5) showed that 45 (62%) of the isolates contained ≥1, and 20 (31%) contained ≥2, of the nine studied carbapenemase and ESBL genes, mainly VIM (36, 55%) and TEM (24, 37%), but also GES, SHV, IMP, OXA, KPC, CTX, and NDM. Few of these isolates harbored blaKPC (n = 2), and none carried blaNDM or blaOXA, which are the focus of multiple clinical case studies. The 20 (31%) remaining CREC isolates with no detected target gene conceivably could harbor antibiotic resistance genes not targeted in the study, or an alternate carbapenem resistance mechanism, such as loss of outer membrane proteins or efflux pumps/porin mutations, which have been demonstrated previously (Kong et al. 2018).

Table 5

Gene panel profiles of carbapenem and ESBL-resistant E. coli isolates from wastewater

No. of genes positive blaIMP blaKPC blaTEM blaCTX-M blaVIM No. of isolates 
– – – – – 20 
– – – – 
– – – – 16 
– – – – 
– – – 14 
– – – 
– – 
– – 
– – 
 25 36 65 
No. of genes positive blaIMP blaKPC blaTEM blaCTX-M blaVIM No. of isolates 
– – – – – 20 
– – – – 
– – – – 16 
– – – – 
– – – 14 
– – – 
– – 
– – 
– – 
 25 36 65 

Samples were all negative for blaNDM, blaSHV, blaGES, and blaOXA genes.

The 36 blaVIM-containing CREC isolates were distributed by phylogroup as follows (% of 36): group D (19 isolates, 53%), B2 (6, 17%), C (5, 14%), B1 (3, 8%), and A (3, 8%). Thus, 70% of the blaVIM-positive isolates belonged to extraintestinal virulence-associated phylogroups B2 and D. As for distribution by ST, blaVIM occurred in three STc131 isolates (one of which also had blaKPC), one STc405 isolate, and one ST1193 isolate. The high prevalence of blaVIM in our study is notable considering the typical occurrence of this gene within integrons on broad-host-range plasmids. We are unaware of previously published data demonstrating such extensive prevalence of blaVIM among clinical E. coli isolates. Metallo-β-lactamases such as VIM were reported previously to be common worldwide, but rare in Enterobacteriaceae in the USA (Gupta et al. 2011; Nordmann et al. 2011).

CONCLUSIONS

This one-year study of water samples from seven geographically dispersed WWTPs in the USA identified 65 CREC isolates, of which 38 were from ExPEC-associated phlyogroups, including 11 from ExPEC-associated STs. Carbapenem-resistant STc131 was identified in three separate samples from two locations, and other clinically important STs were identified in multiple samples from other locations, demonstrating the plausible release of these organisms into receiving bodies of water.

Antibiotic resistance, including resistance to carbapenems, was not limited to pathogenic E. coli phylotypes or STs, as evidenced by the commensal phylotypes (A and C) also harboring multi-drug resistance patterns. Conceivably, this could be indicative of ectotherms harboring AR E. coli in their intestinal tracts as part of their normal microbiota.

The occurrence of CREC and other AR E. coli with potentially mobile resistance genes in wastewater is concerning because wastewater may serve as a reservoir for gene exchange. This implies a risk of AR E. coli and CREC being disseminated into the environment and thence back to humans, with routes of exposure potentially including contaminated recreational water and land application of biosolids. Our ability to understand the extent of this risk will depend, in part, on more detailed information concerning the fate of AR E. coli, including CREC, introduced in indigenous microbial communities, the rate of horizontal gene transfer in these communities, and how best to define the relative risk associated with both introduced and indigenous AR bacteria (Pepper et al. 2018).

Future studies should address the impact of multiple factors (e.g., geographic location, season, types of wastewater, and treatment plant configuration) on the prevalence of AR in wastewater. Additionally, rapid and reliable methods are needed to allow enumeration and characterization of AR organisms with respect to phylogenetic and clonal background, pathogenic potential, and resistance mechanisms. Identification of genetic factors that impart antibiotic resistance is essential when utilizing wastewater as an epidemiological screening tool for detection of emerging resistance patterns in comparison with clinical isolates from a given geographical locale.

ACKNOWLEDGEMENTS

The US Environmental Protection Agency (EPA), through its Office of Research and Development, funded and managed the research described herein. This work has been subjected to the agency's administrative review and has been approved for external publication. This work was also supported in part by Office of Research and Development, Department of Veterans Affairs (VA). Any opinions expressed in this paper are those of the authors and do not necessarily reflect the views of the EPA or VA; therefore, no official endorsement should be inferred. Any mention of trade names or commercial products does not constitute endorsement or recommendation for use. All the positive control strains for qPCR testing were graciously provided by Drs Johann Pitout and Gisele Pierano from the University at Calgary Medical School, Calgary, Alberta, Canada. We would also like to thank Connie Clabots and Steph Porter for their technical assistance.

REFERENCES

REFERENCES
APHA/AWWA/WEF
2017
Standard Methods for the Examination of Water and Wastewater
,
23rd edn
.
American Public Health Association/American Water Works Association/Water Environment Federation
,
Washington, DC
,
USA
.
Bailey
J. K.
,
Pinyon
J. L.
,
Anantham
S.
&
Hall
R. M.
2010
Commensal Escherichia coli of healthy humans: a reservoir for antibiotic-resistance determinants
.
J. Med. Microbiol.
59
,
1331
1339
.
Boczek
L.
,
Rice
E. W.
,
Johnston
B.
&
Johnson
J. R.
2007
Occurrence of antibiotic-resistant uropathogenic Escherichia coli Clonal Group A in wastewater effluents
.
Appl. Environ. Microbiol.
73
(
13
),
4180
4184
.
Boczek
L.
,
Johnson
C.
&
Meckes
M.
2010
Chlorine disinfection of blended municipal wastewater effluents
.
Water Environ. Res.
82
(
12
),
2373
2379
.
Clermont
O.
,
Christenson
J. K.
,
Denamur
E.
&
Gordon
D. M.
2012
The Clermont Escherichia coli phylo-typing method revisited: improvement of specificity and detection of new phylo-groups
.
Environ. Microbiol. Reports
5
(
1
),
58
65
.
CLSI
2012
Performance Standards for Antimicrobial Susceptibility Testing: Twenty Second Informational Supplement
.
CLSI document M100-S22
.
Clinical and Laboratory Standards Institute
,
Wayne, PA
,
USA
.
Dallenne
C.
,
Da Costa
A.
,
Decré
D.
,
Favier
C.
&
Arlet
G.
2010
Development of a set of multiplex PCR assays for the detection of genes encoding important β-lactamases in Enterobacteriaceae
.
J. Antimicrob. Chemother.
65
(
3
),
490
495
.
Edberg
S.
,
Rice
E. W.
,
Karlin
R. J.
&
Allen
M. J.
2000
Escherichia coli: the best biological drinking water indicator for public health protection
.
J. Appl. Microbiol.
88
,
106S
116S
.
Gupta
N.
,
Limbago
B. M.
,
Patel
J. B.
&
Kallen
A. J.
2011
Carbapenem-resistant Enterobacteriaceae: epidemiology and prevention
.
Healthcare Epidemiol.
53
(
1
),
60
67
.
Henriques
I.
,
Fonseca
F.
,
Alves
A.
,
Saavedra
M.
&
Correia
A.
2006a
Occurrence and diversity of integrons and β-lactamase genes among ampicillin-resistant isolates from estuarine waters
.
Res. Microbiol.
157
(
10
),
938
947
.
Henriques
I.
,
Moura
A.
,
Alves
A.
,
Saavedra
M.
&
Correia
A.
2006b
Analysing diversity among β-lactamase encoding genes in aquatic environments
.
FEMS Microbiol. Ecol.
56
(
3
),
418
429
.
Johnson
J. R.
,
Johnston
B.
,
Clabots
C.
,
Kuskowski
M. A.
&
Castanheira
M.
2010
Escherichia coli sequence type ST131 as the major cause of serious multidrug-resistant E. coli infections in the United States
.
Clin. Infect. Dis.
51
(
3
),
286
294
.
Johnson
J. R.
,
Johnston
B. D.
&
Gordon
D. M.
2017
Rapid and specific detection of the Escherichia coli sequence type ST 648 complex within phylogroup F
.
J. Clin. Microbiol.
55
(
4
),
1116
1121
.
Lu
S.
,
Zhang
Y.
,
Geng
S.
,
Li
T.
,
Ye
Z.
,
Zhang
D.
,
Zou
F.
&
Zhou
H.
2010
High diversity of extended-spectrum beta-lactamase-producing bacteria in an urban river sediment habitat
.
Appl. Environ. Microbiol.
76
(
17
),
5972
5976
.
Łuczkiewicz
A.
,
Jankowska
K.
,
Fudala-Książek
S.
&
Olańczuk-Neyman
K.
2010
Antimicrobial resistance of fecal indicators in municipal wastewater treatment plant
.
Water Res.
44
,
5089
5097
.
Marshall
B. M.
,
Ochieng
D. J.
&
Levy
S. B.
2009
Commensals: underappreciated reservoir of antibiotic resistance
.
Microbe
4
(
5
),
231
238
.
Nordmann
P.
,
Naas
T.
&
Poirel
L.
2011
Global spread of carbapenemase-producing Enterobacteriaceae
.
Emerg. Infect. Dis.
17
(
10
),
1791
1798
.
Nordmann
P.
,
Dortet
L.
&
Poirel
L.
2012
Carbapenem resistance in Enterobacteriaceae: here is the storm!
Cell Press
18
,
263
272
.
Pepper
I.
,
Brooks
J.
&
Gerba
C.
2018
Antibiotic resistant bacteria in municipal wastes: is there reason for concern?
Environ. Sci. Technol.
52
,
3949
3959
.
Pitout
J. D. D.
2012
Extraintestinal pathogenic Escherichia coli: a combination of virulence with antibiotic resistance
.
Front. Microbiol.
3
(
9
),
1
7
.
Ryu
H.
,
Griffith
J. F.
,
Khan
I. U. H.
,
Hill
S.
,
Edge
T. A.
,
Toledo-Hernandez
C.
,
Gonzalez-Nieves
J.
&
Santo Domingo
J.
2012
Comparison of gull feces-specific assays targeting the 16S rRNA genes of Catellicoccus marimammalium and Streptococcus spp
.
Appl. Environ. Microbiol.
78
(
6
),
1909
1916
.
Speldooren
V.
,
Heym
B.
,
Labia
R.
&
Nicolas-Chanoine
M.
1998
Discriminatory detection of inhibitor-resistant β-Lactamases in Escherichia coli by single-strand conformation polymorphism-PCR
.
Antimicrob. Agents Chemother.
42
(
4
),
879
884
.
WEF/ASCE/EWRI
1998
Manual of Practice 8; Design of Municipal Wastewater Treatment Plants
,
4th edn
.
Water Environment Federation/American Society of Civil Engineers/Environmental and Water Resources Institute, McGraw-Hill
,
New York
,
USA
.
Weiner
L. M.
,
Webb
A. K.
,
Limbago
B.
,
Dudeck
M. A.
,
Patel
J.
,
Kallen
A. J.
,
Edwards
J. R.
&
Sievert
D. M.
2016
Antimicrobial-resistant pathogens associated with healthcare-associated infections: summary of data reported to the national healthcare safety network at the centers for disease control and prevention, 2011–2014
.
Infect. Control Hosp. Epidemiol.
37
(
11
),
1288
1301
.
Weissman
S. J.
,
Johnson
J. R.
,
Tchesnokova
V.
,
Billig
M.
,
Dykhuizen
D.
,
Riddell
K.
,
Rogers
P.
,
Qin
X.
,
Butler-Wu
S.
,
Cookson
B. T.
,
Fang
F. C.
,
Scholes
D.
,
Chattopadhyay
S.
&
Sokurenko
E.
2012
High-resolution two-locus clonal typing of extraintestinal pathogenic Escherichia coli
.
Appl. Environ. Microbiol.
78
(
5
),
1353
1360
.

Supplementary data