Abstract

Water-borne diseases like diarrheagenic Escherichia coli (DEC)-induced gastroenteritis are major public health problems in developing countries. In this study, the microbiological quality of water from mines and shallow wells was analyzed for human consumption. Genotypic and phenotypic characterization of DEC strains was performed. A total of 210 water samples was analyzed, of which 153 (72.9%) contained total coliforms and 96 (45.7%) E. coli. Of the E. coli isolates, 27 (28.1%) contained DEC genes. The DEC isolates included 48.1% Shiga toxin-producing E. coli (STEC), 29.6% enteroaggregative E. coli (EAEC), 14.9% enteropathogenic E. coli (EPEC), 3.7% enterotoxigenic E. coli (ETEC), and 3.7% enteroinvasive E. coli (EIEC). All the STECs had cytotoxic effects on Vero cells and 14.8% of the DEC isolates were resistant to at least one of the antibiotics tested. All DEC formed biofilms and 92.6% adhered to HEp-2 cells with a prevalence of aggregative adhesion (74%). We identified 25 different serotypes. One EPEC isolate was serotype O44037:H7, reported for the first time in Brazil. Phylogenetically, 63% of the strains belonged to group B1. The analyzed waters were potential reservoirs for DEC and could act as a source for infection of humans. Preventive measures are needed to avoid such contamination.

INTRODUCTION

Waterborne diseases are major public health problems in developing countries. It is estimated that contaminated water caused more than 15 million deaths, of which more than 80% were children under five years of age (WHO 2014). Although the total number of deaths attributable to diarrhea declined substantially between 1990 and 2012, a lack of access to safe drinking water, sanitation, and adequate hygiene still accounts for the death of more than a thousand children each day worldwide (Chakravarty et al. 2017). Despite reductions in mortality, the morbidity attributable to diarrhea remains unchanged at about 1.7 billion cases per year (Chakravarty et al. 2017).

Among the various contaminants in drinking water, microorganisms are considered one of the most serious in regards to public health hazards. The United States Environmental Protection Agency (USEPA) recommends the use of Escherichia coli as an indicator organism of fecal contamination by humans and other endothermic animals, as well as a potential indicator of the presence of pathogenic microorganisms (USEPA 2017).

Diarrheagenic E. coli (DEC) is one of the major groups of etiologic agents responsible for intestinal infections. These microorganisms account for up to 40% of acute diarrhea episodes in children in developing countries (Miliwebsky et al. 2016). This group of bacteria also plays a considerable causative role in diarrhea in Brazil, in both children and adults (Spano et al. 2017).

DEC strains are classified into eight pathotypes: enteropathogenic E. coli (EPEC), enterotoxigenic E. coli (ETEC), enteroinvasive E. coli (EIEC), Shiga toxin-producing E. coli (STEC), enteroaggregative E. coli (EAEC), diffusely adherent E. coli (DAEC), adherent invasive E. coli (AIEC), and Shiga toxin producing enteroaggregative E. coli (STEAEC). The STEC pathotype also contains the sub-category enterohemorrhagic E. coli (EHEC) (Clements et al. 2012).

DEC transmission typically involves a fecal–oral route involving contaminated sources of food or water and may be involved in outbreaks of waterborne diarrhea (Park et al. 2018).

Alternative groundwater extraction sources, such as mines and shallow wells, are more susceptible to contamination by domestic sanitary sewage because of their shallower depth, and are often used for water supply in rural areas. Therefore, the use of these sources for potable water is a health risk for this population (WHO 2011).

The objective of the current study was to evaluate the microorganisms of groundwater, non-treated water from mines and shallow wells that are used as sources of water for human consumption in southern Brazil and to characterize the genotypic and phenotypic properties of the DEC strains isolated.

METHODS

Water samples

A total of 210 in natura water samples for human consumption were collected from shallow wells and mines located in rural areas of the northern state of Paraná, southern Brazil, from May to August 2017. The properties were chosen by sanitary surveillance technicians and the samples were collected only once from each property, always with the inspection of sanitary surveillance technicians. The samples were collected in 500 mL sterile glass vials and transported in chilled isothermal boxes to the laboratory where they were stored at 4 °C until analyzed. The time span from collection to analysis did not exceed 6 hours.

Analysis of total coliforms and E. coli

The technique used for the detection and quantification of total coliforms and E. coli was the defined substrate method Colilert (IDEXX Laboratories, Sovereign, USA), in accordance with methodology approved by the USEPA (2017), as described by Schuroff et al. (2014). After incubation of the Quanti-Tray cartons (WP2000), quantitative estimates of the most probable number (MPN) of total coliforms and E. coli were determined according to the manufacturer's instructions.

For the isolation of the E. coli strains, the carton wells that displayed changes in the media color to yellow and acquired blue-fluorescent coloration against UV light were used to seed MacConkey agar plates (Difco®, USA) and incubated at 37 °C for 24 hours. After incubation, three to five colonies from each plate demonstrating presumptive characteristics of E. coli were submitted for biochemical identification using EPM, MILi, and Simmons Citrate media (PROBAC, BR). Isolates biochemically identified as E. coli were stored at −80 °C in heart and brain infusion broth (BHI; Difco®, USA) containing 20% (v/v) glycerol (Sigma, USA).

DEC genotypical characterization

DNA was extracted from the bacterial isolates by boiling, as previously described by Lascowski et al. (2013). The supernatants containing the DNA were then used for the identification of the DEC strains and their classification into phylogenetic groups. A total of 370 E. coli isolates, obtained from 96 water samples that were positive for E. coli, were analyzed for DEC identification. The stx1, stx2, and eae genes were used to identify STEC and EHEC strains; eae and bfp for identifying typical EPEC (tEPEC) and atypical EPEC (aEPEC) strains; ST-1a, ST-1b, and elt for identifying ETEC strains; ipaH for identifying EIEC strains; aatA, aggR, aaiA, and aaiC for identifying typical EAEC (tEAEC) and atypical (aEAEC). The results are summarized in Table 1.

Table 1

Primer sequence, size of products obtained and references used for the genes researched

Gene Primer sequence (5′–3′) Amplicon size (bp) Reference 
bfpA (F) CAATGGTGCTTGCGCTTGGT 326 Gunzburg et al. (1995)  
 (R) GCCGCTTTATCCAACCTGGT   
eae (F) GACCCGGCACAAGCATAAGC 384 Paton & Paton (1998)  
 (R) CCACCTGCAGCAACAAGAGG   
stx1 (F) ATAAATCGCCATTCGTTGACTAC 180 Paton & Paton (1998)  
 (R) AGAACGCCCACTGAGATCATC   
stx2 (F) GGCACTGTCTGAAACTGCTCC 255 Paton & Paton (1998)  
 (R) TCGCCAGTTATCTGACATTCTG   
ST 1a (F) TCTGTATTATCTTTCCCCTC 186 Schultsz et al. (1994)  
 (R) ATAACATCCAGCACAGGC   
ST 1b (F) CCCTCAGGATGCTAAACCAG 166 Schultsz et al. (1994)  
 (R) TTAATAGCACCCGGTACAAGC   
elt (F) GGCGACAGATTATACCGTGC 450 Aranda et al. (2004)  
 (R) CGGTCTCTATATTCCCTGTT   
aatA (F) CTGGCGAAAGACTGTATCATC 630 Schmidt et al. (1995)  
 (R) AATGTATAGAAATCCGCTGTT   
aggR (F) GCAATCAGATTAARCAGCGATACA 426 Boisen et al. (2012)  
 (R) CATTCTTGATTGCATAAGGATCTGG   
aaiA (F) CCCACGACCAGATAACG 476 Dudley et al. (2006)  
 (R) GTTTTCAGGATTGCCATTAG   
aaiC (F) ATTGTCCTCAGGCATTTCACACG 215 Lima et al. (2013)  
 (R) ACACCCCTGATAAACAA   
ipaH (F) GTTCCTTGACCGCCTTTCCGATACCGTC 600 Aranda et al. (2004)  
 (R) GCCGGTCAGCCACCCTCTGAGAGTAC   
Gene Primer sequence (5′–3′) Amplicon size (bp) Reference 
bfpA (F) CAATGGTGCTTGCGCTTGGT 326 Gunzburg et al. (1995)  
 (R) GCCGCTTTATCCAACCTGGT   
eae (F) GACCCGGCACAAGCATAAGC 384 Paton & Paton (1998)  
 (R) CCACCTGCAGCAACAAGAGG   
stx1 (F) ATAAATCGCCATTCGTTGACTAC 180 Paton & Paton (1998)  
 (R) AGAACGCCCACTGAGATCATC   
stx2 (F) GGCACTGTCTGAAACTGCTCC 255 Paton & Paton (1998)  
 (R) TCGCCAGTTATCTGACATTCTG   
ST 1a (F) TCTGTATTATCTTTCCCCTC 186 Schultsz et al. (1994)  
 (R) ATAACATCCAGCACAGGC   
ST 1b (F) CCCTCAGGATGCTAAACCAG 166 Schultsz et al. (1994)  
 (R) TTAATAGCACCCGGTACAAGC   
elt (F) GGCGACAGATTATACCGTGC 450 Aranda et al. (2004)  
 (R) CGGTCTCTATATTCCCTGTT   
aatA (F) CTGGCGAAAGACTGTATCATC 630 Schmidt et al. (1995)  
 (R) AATGTATAGAAATCCGCTGTT   
aggR (F) GCAATCAGATTAARCAGCGATACA 426 Boisen et al. (2012)  
 (R) CATTCTTGATTGCATAAGGATCTGG   
aaiA (F) CCCACGACCAGATAACG 476 Dudley et al. (2006)  
 (R) GTTTTCAGGATTGCCATTAG   
aaiC (F) ATTGTCCTCAGGCATTTCACACG 215 Lima et al. (2013)  
 (R) ACACCCCTGATAAACAA   
ipaH (F) GTTCCTTGACCGCCTTTCCGATACCGTC 600 Aranda et al. (2004)  
 (R) GCCGGTCAGCCACCCTCTGAGAGTAC   

The strain identification was performed using polymerase chain reaction (PCR) amplification of the specific target genes on a GeneAmp® PCR System 9,700 thermocycler (Applied Biosystems, USA). Each of the bacterial DNA amplification reactions contained 2 μL of the bacterial-DNA lysate, 0.2 mM dNTPs, 2.0 mM MgCl2, 20 pmol of each oligonucleotide primer, 1 U of Taq DNA polymerase (Invitrogen™), 1× reaction buffer, and sterile Milli-Q (Millipore) water at a final volume of 25 μL. Seven microliters of the amplified product was analyzed by 1.5%–2% agarose gel electrophoresis (Invitrogen™) using Tris Borate EDTA (TBE) buffer. A 100 bp ladder (Invitrogen™) was used as a molecular size marker. The gels were stained with SYBR SAFE solution (Invitrogen™) and visualized under ultraviolet light transillumination (Vilbert Loumart, France). The positive controls included EHEC EDL933 for the stx1, stx2, and eae genes; EPEC E2348/69 for bfpA; EAEC 042 for aaiA, aaiC, aatA, and aggR; ETEC H10407 for ST-1a and elt; ETEC 4083 for ST-1b; and EIEC EDL1284 for ipaH.

Determination of phylogenetic groups

The strains positive for the presence of DEC virulence genes were subsequently tested by PCR for the presence of the genes chuA, yjaA, arpA, and trpA and for the DNA fragment TSPE4.C2. The results were used for characterization of the strains relative to the phylogenetic groups A, B1, B2, C, D, E, and F according to Clermont et al. (2013).

Serotyping

The serotyping of the DEC isolates was performed by microagglutination (Navarro et al. 2016) using rabbit sera against somatic antigens (O1 to O187) and flagellar antigens (H1 to H53) from E. coli and against 46 different somatic antigens from Shigella sp.

Adherence assay

The DEC isolates were tested for adhesion in HEp-2 cells according to the technique described by Cravioto et al. (1979). The assay was performed allowing 6 hours of bacterial–cell interaction and then evaluated using light microscopy.

Biofilm formation test

Biofilm formation was evaluated using the method described by Wakimoto et al. (2004). Biofilm formation was considered positive when the optical density at 570 nm (OD 570) was greater than 0.2 OD units. EAEC strain 042 was used as a positive control and E. coli HB101 (E. coli K-12) was used as a negative control.

Antimicrobial susceptibility test

The bacterial strains were submitted to antimicrobial susceptibility testing using the disk diffusion technique as described by the Clinical Laboratory Standards Institute (CLSI 2016). The antimicrobial agents used were ampicillin (AMP) 10 μg, cefoxitin (CFO) 30 μg, cephalothin (CFL) 30 μg, ciprofloxacin (CIP) 5 μg, nalidixic acid (NAL) 30 μg, piperacillin-tazobactam (PPT) 100/10 μg, ampicillin-sulbactam (ASB) 10/10 μg, amicacin (AMI) 30 μg, gentamicin (GEN) 10 μg, and chloramphenicol (CLO) 30 μg.

STEC cytotoxicity in Vero cells

Production of Stx toxin by the STEC isolates was verified by Vero cell cytotoxicity assays as previously described by Beutin et al. (2002), with modifications. Supernatants from E. coli strains EDL933 and HB101 were used as positive and negative controls, respectively. The cytotoxicity of the isolates was quantified according to the metabolic activity of the cells by the MTT assay (3-(4,5-dimethyl-thiazol-2-yl)-2,5-diphenyl-tetrazolium bromide; Sigma-Aldrich, USA) which evaluates the metabolism of tetrazolium salts by the mitochondria in viable cells (Murakami et al. 2000). The percentage of cytotoxicity was calculated using the following formula: (absorbance of the sample − absorbance of the negative control)/(absorbance of the positive control − absorbance of the negative control) × 100. The absorbance was measured by spectrophotometry at 570 nm in a Multiskan EX ELISA reader (Labsystems, Finland).

An isolate was considered cytotoxic when it induced 50% or greater cell death.

RESULTS

Presence of total coliforms and E. coli

Of the 210 water samples collected from mines and shallow wells, 72.9% (153/210) were contaminated with coliforms. The prevalence of E. coli was 45.7% (96/210). Of the 96 water samples positive for E. coli, 370 E. coli isolates were isolated and evaluated for the presence of DEC genes.

DEC identification

DEC-related genes were present in 28.1% of the 96 E. coli positive samples, of which 48.1% included isolates with genotypic characteristics of STEC (eae and stx+), 92.3% were positive for stx2, and 7.7% positive for stx1. The remaining DEC isolates were 11.1% tEAEC (aggR+), 18.6% aEAEC (aaiA+ and aggR ), 3.7% tEPEC (eae+ and bfp+), 11.1% EPECa (eae), 3.7% ETEC (ST-1a+), and 3.7% for EIEC (ipaH+) (Table 2).

Table 2

Genotypic and phenotypic characteristics of DEC isolated from water samples from mines and shallow wells of the northern region of Paraná, Brazil

No. of isolate Genotypic profile Serotype Phenotypic profile
 
Phylogenetic group Pathotype 
Stxa HEp-2b Biofilm formation Resistance profile 
185 eae O44037:H7 ND CLA PPT B1 aEPEC 
245 eae O145:H34 ND LAL Susceptible B2 aEPEC 
349 eae O109:H21 ND LAL Susceptible B2 aEPEC 
326 eae, bfp O132:H34 ND LA/AA Susceptible B1 tEPEC 
20 stx2 O103:H7 AA Susceptible B1 STEC 
stx2 O185:H16 AA Susceptible B1 STEC 
27 stx2 O4:H12 AA PPT STEC 
216 stx2 O73:H12 AA Susceptible STEC 
222 stx2 O103:H16 AA Susceptible B1 STEC 
15 stx2 O139:H7 NA Susceptible B1 STEC 
22 stx2 O91:H10 AA Susceptible B1 STEC 
54 stx2 O150:H8 DA Susceptible B1 STEC 
58 stx2 O49:H49 NA Susceptible STEC 
62 stx2 O6:H49 AA Susceptible B1 STEC 
141 stx2 O91:H21 AA Susceptible B1 STEC 
146 stx2 O64474:H12 UND Susceptible STEC 
240 stx1 O107:HNT AA CFOc B2 STEC 
99 aggR O64474:H2 ND AA Susceptible B1 tEAEC 
138 aggR O64474:H2 ND AA Susceptible B1 tEAEC 
269 aggR O8:H48 ND AA Susceptible B1 tEAEC 
134 aaiA O69:H- ND AA Susceptible aEAEC 
310 aaiA O48:H21 ND AA Susceptible B1 aEAEC 
355 aaiA O88:HNT ND AA CFO aEAEC 
358 aaiA O91:H21 ND AA Susceptible B1 aEAEC 
362 aaiA O140:H21 ND AA Susceptible B1 aEAEC 
stI-a O150:H20 ND AA Susceptible ETEC 
181 ipaH O93:H20 ND AA Susceptible B1 EIEC 
No. of isolate Genotypic profile Serotype Phenotypic profile
 
Phylogenetic group Pathotype 
Stxa HEp-2b Biofilm formation Resistance profile 
185 eae O44037:H7 ND CLA PPT B1 aEPEC 
245 eae O145:H34 ND LAL Susceptible B2 aEPEC 
349 eae O109:H21 ND LAL Susceptible B2 aEPEC 
326 eae, bfp O132:H34 ND LA/AA Susceptible B1 tEPEC 
20 stx2 O103:H7 AA Susceptible B1 STEC 
stx2 O185:H16 AA Susceptible B1 STEC 
27 stx2 O4:H12 AA PPT STEC 
216 stx2 O73:H12 AA Susceptible STEC 
222 stx2 O103:H16 AA Susceptible B1 STEC 
15 stx2 O139:H7 NA Susceptible B1 STEC 
22 stx2 O91:H10 AA Susceptible B1 STEC 
54 stx2 O150:H8 DA Susceptible B1 STEC 
58 stx2 O49:H49 NA Susceptible STEC 
62 stx2 O6:H49 AA Susceptible B1 STEC 
141 stx2 O91:H21 AA Susceptible B1 STEC 
146 stx2 O64474:H12 UND Susceptible STEC 
240 stx1 O107:HNT AA CFOc B2 STEC 
99 aggR O64474:H2 ND AA Susceptible B1 tEAEC 
138 aggR O64474:H2 ND AA Susceptible B1 tEAEC 
269 aggR O8:H48 ND AA Susceptible B1 tEAEC 
134 aaiA O69:H- ND AA Susceptible aEAEC 
310 aaiA O48:H21 ND AA Susceptible B1 aEAEC 
355 aaiA O88:HNT ND AA CFO aEAEC 
358 aaiA O91:H21 ND AA Susceptible B1 aEAEC 
362 aaiA O140:H21 ND AA Susceptible B1 aEAEC 
stI-a O150:H20 ND AA Susceptible ETEC 
181 ipaH O93:H20 ND AA Susceptible B1 EIEC 

ND, not done; CLA, chain-like adherence; LAL, localized adherence-like; LA, localized adherence; AA, aggregative adherence; NA, non-adherence; UND, undefined pattern; DA, diffuse adherence; PPT, piperacillin-tazobactam; CFO, cefoxitin; H-, non-mobile; NTH, non-typing H antigen.

aCytotoxic effect on Vero cells.

bAdherence patterns to HEp-2 cells.

cIntermediate resistance.

Phylogenetic classification

Of the 27 isolates determined to be DEC strains based on genotypic analysis, 63% were classified to the phylogenetic group B1, 18.5% to the phylogenetic group C, 11.1% to the phylogenetic group B2, and 7.4% to the phylogenetic group E. Of the 13 STEC isolates, 61.5% belonged to group C, 15.4% to group E, and 7.7% to group B2. None of the isolates belonged to phylogenetic groups A, D, or F (Table 2).

Serotyping

Among the 27 DEC isolates, 25 different serotypes were identified. Two tEAEC isolates shared the same O64474:H2 serotype, and two other strains from genotypes STEC and aEAEC shared the serotype O91:H21 (Table 2). In genotype aEPEC, we found the serotypes O44037:H7, O145:H34, and O109:H21 and in genotype tEPEC, serotype O132:H34. In the STEC isolates, serotypes O103:H7, O185:H16, O4:H12, O73:H12, O103:H16, O139:H7, O91:H10, O150:H8, O49:H49, O6:H49, O91:H21, O64474:H12, and O107:HNT were identified. In tEAEC DEC strains, serotypes O64474:H2 and O8:H48 were identified. For genotype EAECa strains, serotypes O69:H − , O48:H21, O88:HNT, O91:H21, and O140:H21 were detected. In ETEC and EIEC isolates, we identified serotypes O150:H2O and O93:H2O, respectively.

Adherence in HEp-2 cells

Of the 27 isolates from the DEC, 92.6% were adherent. For the 13 STEC isolates, 69.2% demonstrated aggregative adherence (AA), 15.4% were non-adherent (NA), 7.7% demonstrated diffuse adherence (DA), and 7.7% were non-characterized. All EAEC, EIEC, and ETEC isolates demonstrated AA phenotypes. Of the three aEPEC isolates, 33.3% presented chain-like adhesion (CLA) and 66.7% showed localized-like adherence (LAL). The tEPEC strain had a mixed adhesion pattern of localized with aggregative adherence (LA/AA).

Biofilm

Biofilm formation (O.D. 570 > 0.2) was identified in all DEC isolates (Figure 1).

Figure 1

Biofilm formation by DEC isolates.

Figure 1

Biofilm formation by DEC isolates.

Susceptibility to antimicrobials

Susceptibility to ten antibiotics was examined in the 27 DEC isolates. Most (85.2%) did not demonstrate resistance to the antibiotics tested. Only 14.8% were resistant to one of the antibiotics. Two isolates (7.4%) were resistant to PPT, one (3.7%) to cefoxitin, and one (3.7%) presented intermediate resistance to cefoxitin.

Cytotoxic effect in Vero cells

All the supernatants of the STEC isolates induced cytotoxic effects in Vero cells. The level of cytotoxic activity ranged from 51.9% to 69.8% (Figure 2).

Figure 2

Cytotoxicity in Vero cells of STEC isolates.

Figure 2

Cytotoxicity in Vero cells of STEC isolates.

DISCUSSION

The identification of fecal microorganisms in drinking water is desirable in order to reduce the potential contact between humans and enteric pathogens. E. coli is the most commonly used microorganism as an indicator of recent fecal contamination (WHO 2011). Our results showed that 72.9% of the water samples analyzed were unfit for human consumption, according to Ministry of Health Ordinance No. 2914/2011, which states that drinking water must not have total coliforms and E. coli (Brazil 2011). In general, groundwater contamination is related to land use such as livestock and domestic septic systems. To avoid further contamination and to mitigate the risks to human health, appropriate management actions must be implemented (Gambero et al. 2017).

Epidemiological studies in Brazil involving DEC isolates in water intended for human consumption are scarce. In the present study, five DEC pathotypes were found with STEC carriers of the stx2 gene being the most prevalent.

All strains of STEC isolated in this study were cytotoxic in Vero cells. Considering that epidemiologically the Stx2 toxin is strongly associated with serious diseases in humans causing serious damage to endothelial cells, which can lead to hemorrhagic (CH) and uremic hemolytic syndrome (HUS), STECs are a public health concern (Mohawk & O'Brien 2011).

Lascowski et al. (2013), studying STEC in water samples from the same region in the northern region of Paraná, Brazil, found that of the 12 STEC strains isolated, 10 had the stx2 gene (88.3%). Another study by Schuroff et al. (2014), also in this region, while searching for EPEC and STEC in decanter sludge and filter wash water samples from two water treatment plants, found 2.9% of the DEC strains to be EPEC and 4.7% to be STEC genotypes, thus showing that STEC is a pathotype often found in this region.

EPEC, EHEC, and EAEC have been associated with outbreaks of gastroenteritis in South Korea due to the consumption of contaminated groundwater (Park et al. 2018). In our study, aEAEC was the second most prevalent pathotype. Furthermore, a study conducted in the capital of Zimbabwe, South Africa, showed that 63% of drinking water samples were contaminated by E. coli, and of all the DEC strains evaluated, only EAEC carrying the aaiC gene was found (Navab-Daneshmand et al. 2018).

A study by Assis et al. (2014), also in the state of Paraná, Brazil, showed that of the DEC strains isolated from patients with diarrhea, aEPEC was the most commonly found pathotype. In our study, this pathotype was the third most prevalent, showing that contaminated water can be a source of infection by aEPEC in humans. Kambire et al. (2017) found that 68% of E. coli strains isolated from water belonged to the DEC group; 90% of which were ETEC. These findings differ from the results found in our study, where the prevalence of ETEC was dramatically less (1%). Huang et al. (2012) found DEC in 29.1% of samples from water treatment plants in Taiwan, but no ETEC isolates were found, similarly to our results, where in 210 water samples we isolated only one ETEC. The DEC pathotypes' prevalence seems to change according to the geographical region, but further studies are required to better understand this. Overall, the detection of DEC genes in drinking water highlights the potential risk for environmental transmissibility of these pathogenic strains in various parts of the world.

The assignment of E. coli isolates to phylogenetic groups provides evidence that strains of various phylogenetic groups differ in their phenotypic and genotypic characteristics, ecological niche, ancestry, and the ability to cause disease. Therefore, analyses of phylogenetic groups, together with the detection of virulence factors genes, may be useful tools to predict potential health risks associated with E. coli strains found in the environment (Ishii et al. 2007).

In our study, the B1 phylogenetic group was the most prevalent (62.96%). Walk et al. (2007) demonstrated that most E. coli strains belonging to this phylogenetic group may persist in the environment. Duriez et al. (2001) suggest that strains of phylogenetic groups A, B1, and D predominate in the intestinal microbiota, and that these strains must acquire virulence factors in order to become pathogenic. In contrast, strains belonging to the phylogenetic group B2 are rare, but appear to be potentially virulent and are more often isolated in patients admitted to intensive care units (Mereghetti et al. 2002). In our study, the prevalence of B2 strains was at a much lower frequency than that of B1 strains, which is consistent with the previous studies.

Phylogroup C was the second most prevalent among our isolates, which typically is one of the less frequently detected groups. This phylogroup is proposed to contain strains closely related to, but distinct from, phylogroup B1 (Clermont et al. 2013). This, in part, points to the conclusion that DEC strains isolated from groundwater may constitute a genetically heterogeneous population.

We found 25 different serotypes, including serotypes O64474:H2, O64474:H12, and O44037:H7 that have the same O antigen as does Shigella boydii 16 (Navarro et al. 2010) and S. boydii 18 (Navarro et al. 2016). Serogroup O64474 was first described by Navarro et al. (2010) in ETEC isolates associated with diarrhea in children in Egypt, Bangladesh, and Mexico between 1980 and 2007 and distributed among strains containing flagellar H2, H10, H12, and H34 antigens. In Brazil, serotype O64474:H8 was recently found in E. coli isolated from cheese and contained ExPEC genes (de Campos et al. 2017). In our study, two isolates of tEAEC presented the serotype O64474:H2, and one STEC of the serotype O64474:H12. Together, these studies show that serogroup O64474 may be found in both DEC and non-diarrheagenic E. coli with ExPEC genes.

Serogroup 44037 was also described by Navarro et al. (2016) in a study of 23 strains of E. coli isolated from feces of children and cattle used for the characterization of the somatic antigen and H antigen. Serotyping was performed in 187 O antigens and 53 H antigens of E. coli, and 46 O antigens of Shigella. The 23 strains show a positive reaction to only the O antigens of S. boydii 18. Thus, they suggest a new serogroup of E. coli, O44037, with at least five serotypes (H2, H3, H9, H16, and H48) that have some characteristics of ETEC. In our study, an isolate of aEPEC was identified as serotype 44037:H7, being the first of this serotype to be reported in Brazil. This relationship between Shigella antigens and E. coli antigens has been reported by several investigators including Liu et al. (2008) who found 21 O antigens of Shigella identical or closely related to those found in E. coli.

More than 380 O:H serotypes have already been described for STEC, but only a limited number are associated with disease in humans. Serogroup O103 is a classic serogroup (Karmali et al. 2010) and was found in two strains of STEC in this study. However, the H2 antigen is the most frequently found antigen associated with the O103 antigen (Park et al. 2018), but was not identified in the present study, confirming the heterogeneity within this pathotype.

We also found two strains of STEC with the serotypes O91:H21 and O91:H10. Based on the literature, these serotypes are most commonly associated with STEC strains that cause HUS; however, we also found the serotype O91:H21 in a strain of aEAEC. The presence of the stx2 and eae genes has been a reliable predictor for the ability of strains to cause HUS, but some strains of E. coli, such as those of the O91:H21/H10 serotypes, have no eae gene yet have the capacity to cause this syndrome. In Germany, STEC serogroup O91 is the most prevalent type in adult patients, and the second most isolated type in food samples (Mellmann et al. 2009).

Among the EPEC strains, we found serotype O145:H34 (aEPEC) and O132:H34 (tEPEC), which have been reported to be related to strains of aEPEC and EHEC, strains capable of causing enteric infections in humans (Prager et al. 2009). Serogroup O109 is also related to aEPEC (Peeters et al. 1984) and EHEC (Akiyama et al. 2017), and was found in one of our aEPEC isolates. Thus, we note that the pathotypes of DEC have a great heterogeneity in relation to the serotypes. That is, the same serotype can be found in two or more different subgroups of DEC.

An important initial step in the colonization of the human gastrointestinal tract by bacteria is adhesion of the microorganism to the surface of the host. In this study, 92.6% of the isolated DEC were adherent. Of these, 74% demonstrated an AA pattern in cultures of HEp-2 cells, despite being characteristic of EAEC; the AA phenotype was also found in STEC strains, ETEC, EIEC, and EPEC, which did not present the EAEC genes screened.

Chain-like adhesion was first described by Gioppo et al. (2000) in tEAEC. In our study this phenotype was observed in an aEPEC strain.

In 2011, a strain of EAEC O104:H4 harboring the stx gene and exhibiting the AA phenotype caused a major outbreak in Germany, drawing attention to the aggregative phenotype as an important factor in pathogenesis (Bielaszewska et al. 2011).

Studies have attempted to identify genes coding for mixed adhesion phenotypes in DEC, such as the study by Scaletsky et al. (1999) with EPEC strains exhibiting LA and DA, and the work of Garcia et al. (2016) in which EPEC expressed LA and AA. In our study, we also found a tEPEC strain exhibiting the LA and AA adhesion patterns. Further studies are planned to better characterize this strain.

All the DEC strains studied have the ability to form biofilms, which facilitates the survival of microorganisms in adverse environments such as in drinking water systems where they represent a potential source of contamination (Wingender & Flemming 2011). In the host, biofilm formation protects the bacteria from exposure to innate immune defenses and facilitates the spread of resistance to antibiotics and other virulence factors, thus contributing to the persistence of infection (Kostakioti et al. 2013).

Few studies have been conducted to estimate the frequency of bacteria resistant to antibiotics in isolates from groundwater intended for consumption. Of the isolated DEC strains in our study, 7.4% demonstrated resistance to PPT and 7.4% to cefoxitin. In Ireland, high levels of resistance (93%) were found to aminoglycosides in isolates from groundwater from private wells. In California, among E. coli isolates from groundwater samples at a dairy farm, only one sample showed resistance to ceftriaxone, chloramphenicol, and tetracycline (Li et al. 2014). These data, in concordance with findings from the present study, point to a variable frequency of antibiotic resistance in E. coli isolated from groundwater.

The presence of antibiotic-resistant bacteria in the environment represents a serious public health problem because, potentially, it reduces the efficacy of antibiotics used to treat infections, contributing to a higher incidence of disease and higher mortality (Amaya et al. 2011). Although in our study we found a relatively high sensitivity to antimicrobial agents, we highlight the potential risk of contamination of groundwater with resistant bacteria. We believe there is a need for further research to establish the prevalence of antibiotic resistance in the hydrogeological environment, since groundwater is an important resource worldwide, especially in rural areas.

CONCLUSIONS

In conclusion, we infer from our findings that the natural groundwater that was analyzed in the present work was a potential source of DEC transmission. New studies are required and should contribute to an improved understanding of the epidemiology of these pathogens. We emphasize the need for changes in the policies and behavior of the population that uses these water sources. In addition, knowledge regarding the presence of these pathogens should serve to alert the regulatory agencies, health officials, and educators, the potential drivers for appropriate interventions and reassessment of current contamination and disease prevention strategies.

ACKNOWLEDGEMENTS

We thank the Laboratory of Virology at the State University of Londrina for supplying HEp-2 cell cultures, and the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) for financial support.

REFERENCES

REFERENCES
Akiyama
Y.
,
Futai
H.
,
Saito
E.
,
Ogita
K.
,
Sakae
H.
,
Fukunaga
M.
,
Tsuji
H.
,
Chikahira
M.
&
Iguchi
A.
2017
Shiga toxin subtypes and virulence genes in Escherichia coli isolated from cattle
.
Japanese Journal of Infectious Diseases
70
(
2
),
181
185
.
doi: 10.7883/yoken.JJID.2016.100
.
Amaya
E.
,
Reyes
D.
,
Vilchez
S.
,
Paniagua
M.
,
Möllby
R.
,
Nord
C.
&
Weintraub
A.
2011
Antibiotic resistance patterns of intestinal Escherichia coli isolates from Nicaraguan children
.
Journal of Medical Microbiology
60
(
2
),
216
222
.
doi:10.1099/jmm.0.020842-0
.
Aranda
K. R. S.
,
Fagundes-neto
U.
&
Scaletsky
I. C. A.
2004
Evaluation of multiplex PCRs for diagnosis of infection with diarrheagenic Escherichia coli and Shigella spp
.
Journal of Clinical Microbiology
42
(
12
),
5849
5853
.
doi: 10.1128/JCM.42.12.5849-5853.2004
.
Assis
F. E.
,
Wolf
S.
,
Surek
M.
,
De Toni
F.
,
Souza
E. M.
,
Pedrosa
F. O.
,
Farah
S. M.
,
Picheth
G.
&
Fadel-Picheth
C. M.
2014
Impact of Aeromonas and diarrheagenic Escherichia coli screening in patients with diarrhea in Paraná, Southern Brazil
.
The Journal of Infection in Developing Countries
8
(
12
),
1609
1614
.
doi: 10.3855/jidc.4434
.
Beutin
L.
,
Zimmermann
S.
&
Gleier
K.
2002
Evaluation of the VTEC-Screen ‘Seiken’ test for detection of different types of Shiga toxin (Verotoxin)-producing Escherichia coli (STEC) in human samples
.
Diagnostic Microbiology and Infectious Disease
42
(
1
),
1
8
.
doi:10.1016/S0732-8893(01)00325-X
.
Bielaszewska
M.
,
Mellmann
A.
,
Zhang
W.
,
Köck
R.
,
Fruth
A.
,
Bauwens
A.
,
Peters
G.
&
Karch
H.
2011
Characterisation of the Escherichia coli strain associated with an outbreak of haemolytic uraemic syndrome in Germany, 2011: a microbiological study
.
Lancet Infectious Diseases
11
(
9
),
671
676
.
doi:10.1016/S1473-3099(11)70165-7
.
Boisen
N.
,
Scheutz
F.
,
Rasko
D. A.
,
Redman
J. C.
,
Persson
S.
,
Simon
J.
,
Kotloff
K. L.
,
Levine
M. M.
,
Sow
S.
,
Tamboura
B.
,
Toure
A.
,
Malle
D.
,
Panchalingam
S.
,
Krogfelt
K. A.
&
Nataro
J. P.
2012
Genomic characterization of enteroaggregative Escherichia coli from children in Mali
.
Journal of Infectious Diseases
205
(
3
),
431
444
.
doi: 10.1093/infdis/jir757
.
Brazil
2011
Ordinance of the Ministry of Health n°. 2914 of December 25, 2011 It establishes the procedures and responsibilities related to the control and monitoring of the quality of water for human consumption and its standard of potability. Official Journal of the Union, Brasília, Brazil.
Chakravarty
L.
,
Bhattacharya
A.
&
Das
S. K.
2017
Water, sanitation and hygiene: the unfinished agenda in the World Health Organization South-East Asia Region
.
WHO South-East Asia Journal of Public Health
6
(
2
),
22
33
.
doi: 10.4103/2224-3151.213787
.
Clements
A.
,
Young
J. C.
,
Constantinou
N.
&
Frankel
G.
2012
Infection strategies of enteric pathogenic Escherichia coli
.
Gut Microbes
3
(
2
),
71
87
.
doi: 10.4161/gmic.19182
.
Clermont
O.
,
Christenson
J. K.
,
Denamur
E.
&
Gordon
D. M.
2013
The Clermont Escherichia coli phylo-typing method revisited: improvement of specificity and detection of new phylo-groups
.
Environmental Microbiology Reports
5
(
1
),
58
65
.
doi: 10.1111/1758-2229.12019
.
CLSI
2016
Performance Standards for Antimicrobial Susceptibility Testing
,
26th edn
.
CLSI supplement M100S. Clinical and Laboratory Standards Institute
,
Wayne, PA
,
USA
.
de Campos
A. C. L. P.
,
Puño-Sarmiento
J. J.
,
Medeiros
L. P.
,
Gazal
L. E. S.
,
Maluta
R. P.
,
Navarro
A.
,
Kobayashi
R. K. T.
,
Fagan
E. P.
&
Nakazato
G.
2017
Virulence genes and antimicrobial resistance in Escherichia coli from cheese made from unpasteurized milk in Brazil
.
Foodborne Pathogens and Disease
5
(
2
),
94
100
.
doi: 10.1089/fpd.2017.2345
.
Dudley
E. G.
,
Thomson
N. R.
,
Parkhill
J.
,
Morin
N. P.
&
Nataro
J. P.
2006
Proteomic and microarray characterization of the AggR regulon identifies a pheU pathogenicity island in enteroaggregative Escherichia coli
.
Molecular Microbiology
61
(
5
),
1267
1282
.
doi: 10.1111/j.1365-2958.2006.05281. x
.
Duriez
P.
,
Clermont
O.
,
Bonacorsi
S.
,
Bingen
E.
,
Chaventré
A.
,
Elion
J.
,
Picard
B.
&
Denamur
E.
2001
Commensal Escherichia coli isolates are phylogenetically distributed among geographically distinct human populations
.
Microbiology
147
(
6
),
1671
1676
.
doi: 10.1099/00221287-147-6-1671
.
Gambero
M. L.
,
Blarasin
M.
,
Bettera
S.
&
Albo
J. G.
2017
Genetic diversity of Escherichia coli isolates from surface water and groundwater in a rural environment
.
Journal of Water and Health
15
(
5
),
757
765
.
doi: 10.2166/wh.2017.281
.
Garcia
B. G.
,
Ooka
T.
,
Gotoh
Y.
,
Vieira
M. A.
,
Yamamoto
D.
,
Ogura
Y.
,
Girão
D. M.
,
Sampaio
S. C.
,
Melo
A. B.
,
Irino
K.
,
Hayashi
T.
&
Gomes
T. A.
2016
Genetic relatedness and virulence properties of enteropathogenic Escherichia coli strains of serotype o119:H6 expressing localized adherence or localized and aggregative adherence-like patterns on HeLa cells
.
International Journal of Medical Microbiology
306
(
3
),
152
164
.
doi: 10.1016/j.ijmm.2016.02.008
.
Gioppo
N. M.
,
Elias
W. P.
Jr
,
Vidotto
M. C.
,
Linhares
R. E.
,
Saridakis
H. O.
,
Gomes
T. A.
,
Trabulsi
L. R.
&
Pelayo
J. S.
2000
Prevalence of HEp-2 cell-adherent Escherichia coli and characterisation of enteroaggregative E coli and chain-like adherent E. coli isolated from children with or without diarrhoea, in Londrina, Brazil
.
FEMS Microbiology Letters
190
(
2
),
293
298
.
Gunzburg
S. T.
,
Tornieporth
N. G.
&
Riley
L. W.
1995
Identification of enteropathogenic Escherichia coli by PCR-based detection of the bundle forming pilus gene
.
Journal of Clinical Microbiology
33
(
5
),
1375
1377
.
Huang
S.-W.
,
Hsu
B.-M.
,
Su
Y.-J.
,
Ji
D.-D.
,
Lin
W.-C.
,
Chen
J.-L.
,
Shih
F.-C.
,
Kao
P.-M.
&
Chiu
Y.-C.
2012
Occurrence of diarrheagenic Escherichia coli genes in raw water of water treatment plants
.
Environmental Science and Pollution Research
19
(
7
),
2776
2783
.
doi: 10.1007/s11356-012-0777-4
.
Ishii
S.
,
Meyer
K. P.
&
Sadowsky
M. J.
2007
Relationship between phylogenetic groups, genotypic clusters, and virulence gene profiles of Escherichia coli strains from diverse human and animal sources
.
Applied and Environmental Microbiology
73
(
18
),
5703
5710
.
doi:10.1128/AEM.00275-07
.
Kambire
O.
,
Adingra
A. A.
,
Yao
K. M.
&
Koffi-Nevry
R.
2017
Prevalence of virulence genes associated with diarrheagenic pathotypes of Escherichia coli isolates from water, sediment, fish, and crab in Aby Lagoon, Côte d'Ivoire
.
International Journal of Microbiology
2017
,
1253
1260
.
doi: 10.1155/2017/9532170
.
Karmali
M. A.
,
Gannon
V.
&
Sargeant
J. M.
2010
Verocytotoxin-producing Escherichia coli (VTEC)
.
Veterinary Microbiology
140
(
3–4
),
360
370
.
doi: 10.1016/j.vetmic.2009.04.011
.
Kostakioti
M.
,
Hadjifrangiskou
M.
&
Hultgren
S. J.
2013
Bacterial biofilms: development, dispersal, and therapeutic strategies in the dawn of the postantibiotic era
.
Cold Spring Harbor Perspectives in Medicine
3
(
4
),
a010306
.
Lascowski
K. M. S.
,
Guth
B. E. C.
,
Martins
F. H.
,
Rocha
S. P. D.
,
Irino
K.
&
Pelayo
J. S.
2013
Shiga toxin-producing Escherichia coli in drinking water supplies of north Paraná State, Brazil
.
Journal of Applied Microbiology
114
(
4
),
1230
1239
.
doi:10.1111/jam.12113
.
Li
X.
,
Watanabe
N.
,
Xiao
C.
,
Harter
T.
,
McCowan
B.
,
Liu
Y.
&
Atwill
E. R.
2014
Antibiotic-resistant E. coli in surface water and groundwater in dairy operations in Northern California
.
Environmental Monitoring and Assessment
186
(
2
),
1253
1260
.
doi: 10.1007/s10661-013-3454-2
.
Lima
I. F. N.
,
Boisen
N.
,
Quetz
J. d. S.
,
Havt
A.
,
de Carvalho
E. B.
,
Soares
A. M.
,
Lima
N. L.
,
Mota
R. M. S.
,
Nataro
J. P.
,
Guerrant
R. L.
&
Lima
A. Â. M.
2013
Prevalence of enteroaggregative Escherichia coli and its virulence related genes in a case-control study among children from north-eastern Brazil
.
Journal of Medical Microbiology
62
(
5
),
683
693
.
doi: 10.1099/jmm.0.054262-0
.
Liu
B.
,
Knirel
Y. A.
,
Feng
L.
,
Perepelov
A. V.
,
Senchenkova
S. N.
,
Wang
Q.
,
Reeves
P. R.
&
Wang
L.
2008
Structure and genetics of Shigella O antigens
.
FEMS Microbiology Reviews
32
(
4
),
627
653
.
doi: 10.1111/j.1574-6976.2008.00114
.
Mellmann
A.
,
Fruth
A.
,
Friedrich
A. W.
,
Wieler
L. H.
,
Harmsen
D.
,
Werber
D.
,
Middendorf
B.
,
Bielaszewska
M.
&
Karch
H.
2009
Phylogeny and disease association of Shiga toxin-producing Escherichia coli O91
.
Emerging Infectious Disease Journal
15
(
9
),
1474
1477
.
doi: 10.3201/eid1509.090161
.
Mereghetti
L.
,
Tayoro
J.
,
Watt
S.
,
Lanotte
P.
,
Loulergue
J.
,
Perrotin
D.
&
Quentin
R.
2002
Genetic relationship between Escherichia coli strains isolated from the intestinal flora and those responsible for infectious diseases among patients hospitalized in intensive care units
.
Journal of Hospital Infection
52
(
1
),
43
51
.
doi: 10.1053/jhin.2002.1259
.
Miliwebsky
E.
,
Schelotto
F.
,
Varela
G.
,
Luz
D.
,
Chinen
I.
&
Piazza
R. M. F.
2016
Human diarrheal infections: diagnosis of diarrheagenic Escherichia coli pathotypes
. In:
Escherichia Coli in the Americas
(
Torres
A. G.
, ed.).
Springer International Publishing
,
Cham
,
Switzerland
, pp.
343
369
.
Mohawk
K. L.
&
O'Brien
A. D.
2011
Mouse models of Escherichia coli o157:H7 infection and Shiga toxin injection
.
Journal of Biomedicine and Biotechnology
2011
(
5
),
2581
2585
.
doi: 10.1155/2011/258185
.
Murakami
J.
,
Kishi
K.
,
Hirai
K.
,
Hiramatsu
K.
,
Yamasaki
T.
&
Nasu
M.
2000
Macrolides and clindamycin suppress the release of Shiga-like toxins from Escherichia coli o157:H7 in vitro
.
International Journal of Antimicrobial Agents
15
(
2
),
103
109
.
Navab-Daneshmand
T.
,
Friedrich
M. N. D.
,
Gächter
M.
,
Montealegre
M. C.
,
Mlambo
L. S.
,
Nhiwatiwa
T.
,
Mosler
H. J.
&
Julian
T. R.
2018
Escherichia coli contamination across multiple environmental compartments (soil, hands, drinking water, and handwashing water) in urban Harare: correlations and risk factors
.
The American Journal of Tropical Medicine and Hygiene
98
(
3
),
803
813
.
doi: 10.4269/ajtmh.17-0521
.
Navarro
A.
,
Eslava
C.
,
Perea
L. M.
,
Inzunza
A.
,
Delgado
G.
,
Morales-Espinosa
R.
&
Cravioto
A.
2010
New enterovirulent Escherichia coli serogroup 64474 showing antigenic and genotypic relationships to Shigella boydii 16
.
Journal of Medical Microbiology
59
(
4
),
453
461
.
doi: 10.1099/jmm.0.015602-0
.
Navarro
A.
,
Eslava-Campos
C. A.
,
Melendez-Herrada
E.
&
Cravioto
E.
2016
Escherichia coli derived from different sources share antigenic characteristics with Shigella boydii 18 and virulence factors with enterotoxigenic E. coli
.
International Journal of Advanced Research
4
(
10
),
629
638
.
doi:10.21474/IJAR01/1840
.
Park
J.
,
Kim
J. S.
,
Kim
S.
,
Shin
E.
,
Oh
K. H.
,
Kim
Y.
,
Kim
C. H.
,
Hwang
M. A.
,
Jin
C. M.
,
Na
K.
,
Lee
J.
,
Cho
E.
,
Kang
B. H.
,
Kwak
H. S.
,
Seong
W. K.
&
Kim
J.
2018
A waterborne outbreak of multiple diarrhoeagenic Escherichia coli infections associated with drinking water at a school camp
.
International Journal of Infectious Diseases
66
,
45
50
.
doi: 10.1016/j.ijid.2017.09.021
.
Paton
A. W.
&
Paton
J. C.
1998
Detection, and characterization of Shiga toxigenic Escherichia coli by using multiplex PCR assays for stx1, stx2, eaeA, enterohemorrhagic E. coli hlyA, rfbo111, and rfbo157
.
Journal of Clinical Microbiology
36
(
2
),
598
602
.
Peeters
J. E.
,
Charlier
G. J.
&
Halen
P. H.
1984
Pathogenicity of attaching effacing enteropathogenic Escherichia coli isolated from diarrheic suckling and weanling rabbits for newborn rabbits
.
Infection and Immunity
46
(
3
),
690
696
.
Prager
R.
,
Fruth
A.
,
Siewert
U.
,
Strutz
U.
&
Tschäpe
H.
2009
Escherichia coli encoding Shiga toxin 2f as an emerging human pathogen
.
International Journal of Medical Microbiology
299
(
5
),
343
353
.
doi: 10.1016/j.ijmm.2008.10.008
.
Scaletsky
I. C.
,
Pedroso
M. Z.
,
Oliva
C. A.
,
Carvalho
R. L.
,
Morais
M. B.
&
Fagundes-Neto
U.
1999
A localized adherence-like pattern as a second pattern of adherence of classic enteropathogenic Escherichia coli to HEp-2 cells that is associated with infantile diarrhea
.
Infection and Immunity
67
(
7
),
3410
3415
.
Schmidt
H.
,
Knop
C.
,
Franke
S.
,
Aleksic
S.
,
Heesemann
J.
&
Karch
H.
1995
Development of PCR for screening of enteroaggregative Escherichia coli
.
Journal of Clinical Microbiology
33
(
3
),
701
705
.
Schultsz
C.
,
Pool
G. J.
,
van Ketel
R.
,
de Wever
B.
,
Speelman
P.
&
Dankert
J.
1994
Detection of ETEC in stool samples by using nonradioactively labeled oligonucleotide DNA probes and PCR
.
Journal of Clinical Microbiology
32
(
10
),
2393
2397
.
Schuroff
P. A.
,
Burgos
T. N.
,
Lima
N. R.
,
Lopes
A. M.
&
Pelayo
J. S.
2014
Phenotypic and genotypic characterization of potentially pathogenic Escherichia coli from water treatment plants
.
Arquivos de Ciências da Saúde
21
(
3
),
93
98
.
Spano
L. C.
,
Cunha
K. L.
,
Monfardini
M. V.
,
Fonseca
R. C.
&
Scaletsky
I. C. F.
2017
High prevalence of diarrheagenic Escherichia coli carrying toxin-encoding genes isolated from children and adults in southeastern Brazil
.
BMC Infectious Diseases
17
,
773
.
doi: 10.1186/s12879-017-2872-0
.
USEPA
2017
Analytical Methods Approved for Compliance Monitoring Under the Long Term 2 Enhanced Surface Water Treatment Rule
.
United States Environmental Protection Agency (USEPA)
,
Washington, DC
,
USA
.
Wakimoto
N.
,
Nishi
J.
,
Sheikh
J.
,
Nataro
J. P.
,
Sarantuya
J.
,
Iwashita
M.
,
Manago
K.
,
Tokuda
K.
,
Yoshinaga
M.
&
Kawano
Y.
2004
Quantitative biofilm assay using a microtiter plate to screen for enteroaggregative Escherichia coli
.
The American Journal of Tropical Medicine and Hygiene
71
(
5
),
687
690
.
Walk
S. T.
,
Alm
E. W.
,
Calhoun
L. M.
,
Mladonicky
J. M.
&
Whittam
T. S.
2007
Genetic diversity and population structure of Escherichia coli isolated from freshwater beaches
.
Environmental Microbiology
9
(
9
),
2274
2288
.
doi: 10.1111/j.1462-2920.2007.01341
.
WHO
2011
Guidelines for Drinking-Water Quality
,
4th edn
.
World Health Organization (WHO)
,
Geneva
,
Switzerland
.
WHO
2014
World Health Statistics
.
World Health Organization
,
Geneva
,
Switzerland
. .
Wingender
J.
&
Flemming
H. C.
2011
Biofilms in drinking water and their role as reservoir for pathogens
.
The International Journal of Hygiene and Environmental Health
214
(
6
),
417
423
.
doi: 10.1016/j.ijheh.2011.05.009
.