Abstract

The aim of this study was to identify the main sources of fecal pollution at popular beaches and rivers in the island of Trinidad. Escherichia coli enumeration and microbial source tracking (MST) were used to identify the primary sources of fecal bacteria contamination at the sites. Nineteen sites exceeded USEPA water quality standards for safe recreational use. Highest levels of fecal contamination were recorded on the central and west coasts of the island and included Brickfield River (4,839 MPN 100 ml−1), Orange Valley Bay (2,406.6 MPN 100 ml−1) and Chaguaramas Bay (1,921.2 MPN 100 ml−1). MST detected human (HF183) fecal pollution at ∼63%, birds at ∼67%, chicken at ∼36% and cattle (BacCow) at ∼34% of the sites. MST is a useful and rapid method for identifying major sources of fecal pollution in rivers and beaches. In Trinidad water bodies, the main sources of fecal pollution were humans and birds. The large number of sites with elevated levels of fecal pollution detected is particularly alarming and represents a serious public health risk.

This article has been made Open Access thanks to the generous support of a global network of libraries as part of the Knowledge Unlatched Select initiative.

INTRODUCTION

In the Caribbean, fecal contamination of freshwater and marine environments is a growing threat to human health, tourism and the food industry (Shuval 2003; Walker et al. 2013; Institute of Marine Affairs (IMA) 2016). In the island of Trinidad, heavy industrial development and a long period of agricultural development have contributed to the input of fecal bacteria in freshwater, estuarine and marine systems (Alleng 2007; Bachoon et al. 2010). Over the past two decades, there have been several reports of high levels of fecal contamination at some of the popular beaches, rivers and swamps (Rampersad et al. 1999; Bachoon et al. 2010; Environment Management Association (EMA) 2011; Institute of Marine Affairs (IMA) 2016). The Trinidad and Tobago IMA attributed the presence of fecal contamination at beaches and rivers to seepage of sewage from pit latrines situated along river banks and coastlines, nonfunctional sewage treatment plants, poorly constructed septic tanks and run-off from livestock farming operations (EMA 2011; IMA 2016). As such, contamination of the island's marine and freshwater environments with high levels of fecal pollution, and possibly pathogenic bacteria from human and non-human sources, can present a public health concern. However, in Trinidad, routine monitoring of the level of fecal pollution in rivers and beaches is not conducted and watershed management plans are lacking.

In water quality management systems, regulatory agencies generally focus on fecal indicator bacteria (FIB) and identifying the source of the FIB to adequately assess human health risks and develop watershed management plans (Amador et al. 2008; Bachoon et al. 2010; US EPA 2012). A good FIB should meet certain criteria: easily testable, must be of either animal or human sources, survival time should be close to or longer than pathogens, ability to indicate the presence of several pathogens, and can be used in different water environments such as marine or freshwater (USEPA 1986; USEPA 2006; Sinigalliano et al. 2007; Staley et al. 2013). There is no perfect FIB for recreational water, but the majority of regulatory agencies have opted to use either fecal coliforms (e.g. Escherichia coli) or enterococci as indicators for pathogens in surface waters (Palmer et al. 1993; US EPA 2012; Walker et al. 2013). The acceptable levels of these fecal indicators have been determined during epidemiological studies in the United States, but similar studies have not been conducted in the tropics (USEPA 1986). Although no standard for E. coli has been adopted for marine waters, the geometric mean standard for freshwater should be <126 CFU 100 ml−1 and the statistical threshold value (STV), which is a value that approximates the 90th percentile of the water quality distribution and should not be exceeded by more than 10 percent of the samples taken, fluctuates from 320 to 410 CFU 100 ml−1 (USEPA 2012). For marine waters designated as swimming areas, the geometric mean of enterococci should not exceed 35 CFU 100 ml−1 (USEPA 2012). Bachoon et al. (2010) reported that 7 of 14 sites sampled in Trinidad, including Maracas Bay which is a major public beach, contained unsafe fecal contamination based on USEPA established thresholds. Unfortunately, FIB enumeration cannot be used for fecal source identification; however, establishing the source of fecal pollution is critical to determine the public health risk associated with fecal pollution events.

Recently, several microbial source tracking (MST) methodologies have been developed based on the knowledge that some Bacteroidales species exhibit host specificity (Hemandez et al. 2013; Symonds et al. 2017; Zang et al. 2019). In Trinidad, human fecal pollution is often implicated as the main source of elevated levels of fecal pollution in rivers and beaches, but these assertions are often made without the fecal source tracking analysis (IMA 2016). Previous MST at 14 coastal sites linked human fecal bacteria to only one location (Bachoon et al. 2010), indicating the possibility of non-point sources of animal fecal pollution, impacting many rivers and beaches on the island. The detection of animal fecal sources is relevant to public health because it is well established that they carry many zoonotic pathogens (Wade et al. 2015; Holman et al. 2014; Walker et al. 2013). For example, E. coli O157:H7, a zoonotic pathogen, was detected in 2% of oyster samples tested in Western Trinidad (Rampersad et al. 1999) and at two fishing bays (Walker et al. 2013). Among the most high-risk and likely sources of fecal pollution in Trinidad are human, livestock (cattle, pigs, goat and chicken) and wildlife (e.g. birds). In 2010, a limited scope MST for human and cattle sources of fecal contamination detected human fecal pollution at only Cali Bay on the central west coast of the island (Bachoon et al. 2010). Currently, MST-polymerase chain reaction (PCR) assays have been developed for the detection of human and a wide range of animal fecal sources (Lu et al. 2007; Bachoon et al. 2010; Boehm et al. 2013; Hemandez et al. 2013). One of the most often used MST markers for human fecal pollution is HF183 for Bacteroides dorei (Haugland et al. 2010; Hernandez et al. 2013). Today, there are MST markers for many animal sources of fecal contamination, including chicken and other birds (CP1F/R), chicken (CBR-42F) and cattle (BacCow) (Lu et al. 2007; Haughland et al. 2010). Consequently, it is now possible to conduct a more inclusive study of the likely sources of fecal contamination of water bodies in Trinidad.

The aim of this study was to conduct an island-wide survey of the level and sources of fecal contamination in Trinidad. Thirty-five sampling sites, including 23 marine and 12 freshwater locations were surveyed and for each location, physiochemical parameters were recorded, E. coli levels were determined, and MST assays for human, cattle and birds were conducted. Information obtained will be useful for public health risk assessment and for guiding the development of the most appropriate mitigation steps to improve water quality on the island.

MATERIALS AND METHOD

Sampling sites

In June 2017, duplicate water samples were collected in sterile polypropylene bottles from 23 coastal marine sites and 12 either freshwater or brackish sites, kept on ice and processed within 6 h. The majority of the marine and coastal sites are popular recreational and tourists attractions, and some are used for commercial fishing (Figure 1). Samples were collected from the Caroni Swamp in the area of the popular Bird Sanctuary (bird rookery) and from rivers, including the Valencia, Salybia, Brickfield, Manzanilla ‘Le Branche’, Nariva, Ortoire, Guayaguayare, Oropouche, Maracas and Yarra. Popular beaches sampled included Maracas Bay, Las Cuevas Bay, Macqueripe Bay, Mayaro beach, Quinam and Chaguaramas Bay. Samples were also collected from fishing villages, including Brickfield Fishing Bay, Carli Bay, Orange Valley Fishing Bay and Waterloo in the Gulf of Paria (West coast) and Toco Bay, Balandra Bay, San Souci Bay, Mission Bay and Rampalanagas Bay in the Northeastern coast of the island. Although situated in rural areas, some sites were generally impacted by human settlements, subsistence farming, livestock and poultry production. Sites were classified as urban, suburban and rural based on knowledge of existing population density. A YSI Pro plus Multiparameter meter (YSI incorporated, USA) was used to collect temperature, salinity, pH and dissolved oxygen values for water column profiles at each site.

Figure 1

Map of sampling sites in Trinidad and sites where elevated levels of E. coli concentration were recorded.

Figure 1

Map of sampling sites in Trinidad and sites where elevated levels of E. coli concentration were recorded.

E. coli enumeration and DNA extraction

Processing of samples was done at the Mycology and Microbiology Laboratory, Department of Life Sciences, the University of the West Indies, St. Augustine Campus, Trinidad. One hundred milliliters of each sample was analyzed for E. coli, using USEPA Standard Method 9223, ColilertTM media sealed using a Quanti-Tray sealer and incubated at 35.5 °C for 18 h (USEPA 2007). Fluorescent cells were considered positive for E. coli colonies, and total counts were determined using quantification tables from the manufacturer (IDEXX Laboratories Inc., Westbrook, ME, USA). For DNA extraction, water samples (100 ml) were filtered through a 0.45-μm-pore nitrocellulose membrane filter (Type GS, Millipore, Billerica, MA, USA), and the filters were frozen (−20 °C) and shipped frozen by overnight courier to Georgia College and State University, Milledgeville Georgia. The filters were processed with the MoBio UltracleanTM Soil DNA Kit (Carlsbad, CA, USA) using a modified protocol (Bachoon et al. 2010), and the extracted DNA was quantified using a Nanodrop ND-1000 Spectrophotometer. The A260/280 ratio was determined as an indicator of samples' purity (Wilmington, DE). DNA samples were stored at −20 °C until further use.

Microbial source tracking

Quantitative PCR assays were conducted on a CFX 9600 (Bio RAD) Real-Time PCR system for the detection of human and animal fecal bacteria (Table 1). All primers used in this study were based on sensitivity and selectivity cited previously (Table 1), optimized to avoid nonspecific cross reaction against the appropriate non-target fecal DNA from chicken, cattle, goat and human (with local samples), and increased specificity. PCR assays were conducted with 1 μl of sample DNA (approximately 10 ng/μl) and a ten-fold diluted DNA sample with annealing temperatures and primer/probe sequences for each marker gene as listed in Table 1. Standard curves for each quantitative PCR (qPCR) (controls and samples) were linear and had coefficients of determination (r2) of 0.99. Negative controls without DNA, which were run with each reaction, always exceeded the cycle threshold at a mean Cq of 39.58. Each hydrolysis probe was labeled at the 5′ end with the reporter dye 6-FAM (6-carboxy-fluorescein) and at the 3′ end with the quencher dye TAMRA (6-carboxytetramethyl-rhodamine). For human (HF183), the qPCR assay used a modified protocol of Haugland et al. (2010); with Bacteroides dorei DSM 17855 (DSMZ) and human sewage used as a positive control and E. coli strain B from Sigma® D48890-1UN, cattle and chicken fecal DNA extracts (Trinidad samples) as a negative control. The 25 μl assay contained 0.25 μM of each primer, 0.2 mg of bovine serum albumin (Sigma) and 80 nM of the 6-FAM™ labeled Hydrolysis® probe. Water samples were assessed for possible PCR inhibition by amending with positive control bacteria DNA as described by Bachoon et al. (2010). Changes of less than two CT values were observed, which indicates that the extracted DNA did not contain impurities that significantly inhibited the MST assay (Bustin et al. 2009; Bachoon et al. 2010). In addition, ten-fold dilutions of sample DNA extracts were compared to the undiluted sample DNA extract and a change in the CT shift of <3 CT indicated no significant PCR inhibition (Dick et al. 2010).

Table 1

Primers and probes used for MST of fecal contamination

TargetPrimerSequenceAnnealing temp. (°C)Reference
Human HF-183-1 ATCATGAGTTCACATGTCCG 60 Haugland et al. (2010)  
 BtheR1 CGTAGGAGTTTGGACCGTGT  
 PROBE 6FAM-CTGAGGAGAAGGTCCCCCACATTGGA-TAMRA  
Cattle BacCowF CCAACYTTCCCGWTACTC 57 Bernhard & Field (2000)  
 BacCowR GGACCGTGTCTCAGTTCCAGTG  
 PROBE 6FAM-TAGGGGTTCTGAGAGGAAGGTCCCCC-TAMRA  
Chicken and other birds CP1F GGCAGGCATCAAGTCAACA 64.5 Lu et al. (2007)  
 CP1R TGGCAAAAGCAACTGTCATGG  
Chicken CBR-42F GACGAGATCTATATTTGCCTCA 60 Lu et al. (2007)  
 CBR-42R CGGAGCATATCCTACGATCA  
TargetPrimerSequenceAnnealing temp. (°C)Reference
Human HF-183-1 ATCATGAGTTCACATGTCCG 60 Haugland et al. (2010)  
 BtheR1 CGTAGGAGTTTGGACCGTGT  
 PROBE 6FAM-CTGAGGAGAAGGTCCCCCACATTGGA-TAMRA  
Cattle BacCowF CCAACYTTCCCGWTACTC 57 Bernhard & Field (2000)  
 BacCowR GGACCGTGTCTCAGTTCCAGTG  
 PROBE 6FAM-TAGGGGTTCTGAGAGGAAGGTCCCCC-TAMRA  
Chicken and other birds CP1F GGCAGGCATCAAGTCAACA 64.5 Lu et al. (2007)  
 CP1R TGGCAAAAGCAACTGTCATGG  
Chicken CBR-42F GACGAGATCTATATTTGCCTCA 60 Lu et al. (2007)  
 CBR-42R CGGAGCATATCCTACGATCA  

The samples were run at 95 °C for 15 min, 40 cycles at 95 °C for 10 s, and annealing/extension temperature listed in Table 1 (Wade et al. 2015). The qPCR detection limits were determined from the lowest concentration of target DNA that could be detected at 95% confidence and gene copies ranged from human 8, cattle 20, chicken and other birds 12 and chicken 25 gene copies.

The hydrolysis assays for cattle (BacCow) were performed as above (Bernard & Field 2000; Bradshaw et al. 2016). EvaGreen dye-based assays were used for the detection of chicken and bird fecal pollution with annealing temperatures as specified in Table 1, and following the protocol of Lu et al. (2007). For dye-based assays, the melt curve analysis was performed to confirm positive detection.

RESULTS

Physiochemical parameters

The observed temperature, pH, dissolved oxygen (DO) and salinity values at the sampling sites were typical for the island (Khatri & Tyagi 2015; IMA 2016). The mean water temperature ranged from 25.7 to 39.1 °C with an average temperature of 28.6 °C. DO of all sites ranged from 0.32 to 9.62 mg/l and had an average of 6.17 mg/l. The lowest (DO) value was found at the Brickfield River in the Central/West coast and North-East coast sample sites and the highest at Toco Bay sites. The pH ranged from 8.14 to 9.22 at Oropouche/Gordineau River and Yarra River, respectively, and had an average pH of 8.75. Salinity at the freshwater sites ranged from 0.61 to 5.30 ppt and averaged 25.8 ppt at marine sampling sites.

Fecal bacteria enumeration

E. coli were enumerated at each sampling site based on USEPA recommendations STV (320–410 CFU 100 ml−1) (US EPA 2012), and sites exceeding an STV of 400 CFU 100 ml−1 were deemed unsafe for recreational purposes. Along the densely populated central western region, E. coli counts at all sites exceeded 400 MPN 100 ml−1 and ranged from 541.2 MPN 100 ml−1 at Carli Bay to 4,839.2 MPN 100 ml−1 at Brickfield River (Table 2, Figure 1). E. coli levels were relatively low for the less densely populated North-East coast sampling sites (MPN ranged from 43.2 to 416.8 100 ml−1), and 12 sites had E. coli concentrations below 200 MPN 100 ml−1. Six sites along the north coast of the island, including Chaguaramas Bay, Site 2 at the Trinidad and Tobago Yacht Sailing Association (TTYSA) boat dock and Williams Bay exceeded 400 MPN 100 ml−1 (Table 2). Along the East Coast, E. coli counts were the highest at Guayaguayare fishing depot and the lowest at Mayaro public beach. In the southern region, E. coli levels were between 62.3 and 1,149.6 MPN 100 ml−1. The Mosquito Creek sites exceeded 400 MPN 100 ml−1 (Figure 1, Table 2). Overall, the majority of the 19 sites that had exceedingly high E. coli levels were on the western and central regions of the island (Figure 1).

Table 2

E. coli concentration and detection of MST markers for human (HF183), chicken and other birds (CP1F/CP1R), chicken (CP29F), ruminant (Rum-2-bac), and cattle (BacCow) in the water samples

StationSiteE. coli (MPN/100 ml)HumanAvianChickenCattleClassification
T1 Valencia Middle Course 56.8 
T2 Valencia Lower Course 76.2 – – – 
T3 Salybia river 187.6 – – – 
T4 Salybia river mouth 157.8 – – – – 
T5 Salybia bay 74.2 – – – – 
T6 Balandra Bay Site One 43.2 – – – 
T7 Balandra Bay Site Two 46.6 – – – – 
T8 Rampalanagas beach 387.4 – – 
T9 Toco Bay Site One 72.6 – – 
T10 Toco Bay Site Two 106.8 – – – 
T11 San Souci Bay Site One 110 – – – 
T12 San Souci Bay Site Two 105.4 – – – – 
T13 Missions Bay Site One 416.8 – – – 
T14 Missions Bay Site Two 387.2 – – – 
T15 Brickfield Fishing Bay 3,972.6 
T16 Brickfield River 4,839.2 
T17 Waterloo Sea 2,599.4 
T18 Orange Valley Fishing Bay 2,406.6 
T19 Carli Bay 541.2 – 
T20 Caroni Swamp Boat Dock Site One 784.4 
T21 Caroni Swamp Site Two 1,072.8 
T22 Maracas River 240.5 
T23 Maracas River Mouth 312.3 
T24 Maracas Beach Site One 191.8 – – – 
T25 Maracas Beach Site Two 180.9 – – – 
T26 Tyrico Bay 60.4 – – – – 
T27 Las Cuevas Bay Site One 277.8 
T28 Las Cuevas Bay Site Two 322.3 
T29 La Fillette Beach 472.1 – – – – 
T30 Blanchisseuse Beach 243.6 – – 
T31 Yara River 2,419.6 – – 
T32 Macqueripe Bay 170.8 –  – – SU 
T33 Chaguaramas Bay TTYSA Site One 1,921.2 – SU 
T34 Chaguarama Bay TTYSA Site Two NA – – SU
SU 
T35 Chaguaramas Bay Boardwalk Site One 629.4 SU 
T36 Chaguaramas Bay Boardwalk Site Two 601.5 – SU 
T37 Williams Bay 550.4 – SU 
T38 Manzanilla ‘Le Branche’ River Mouth 231 – – 
T39 Manzanilla Fishing Bay 189.4 – – – – 
T40 Manzanilla Boardwalk 143.7 – – 
T41 Nariva River Mouth 103.1 – 
T42 Ortoire River Mouth 181.1 – – 
T43 Ortoire River Lower Course 169.1 – – – 
T44 Guayaguayare River 281.2 – – 
T45 Guayaguayare Beach/Industrial 150.6 – – – – 
T46 Guayaguayare Sea Wall 115.9 – – 
T47 Guayaguayare Fishing Depot 689.3 – – 
T48 Mayaro Beach Site One 59.5 – – – 
T49 Mayaro Beach Site Two 65.2 – – – – 
T50 Mafeking Bridge/Ortoire River Middle Course 381.1 – – – 
T51 Morne Diablo Beach 62.3 – – 
T52 Quinam Beach Site One 396.8 – 
T53 Quinam Beach Site Two NA – – 
T54 Oropouche/Godineau River 574.8 – – 
T55 Mosquito Creek River Mouth/Godineau Site One 629.4 – 
T56 Mosquito Creek Site Two 960.6 – 
T57 Mosquito Creek Site Three 1,011.2 – 
T58 Kings Warf San Fernando 1,149.6 – – 
StationSiteE. coli (MPN/100 ml)HumanAvianChickenCattleClassification
T1 Valencia Middle Course 56.8 
T2 Valencia Lower Course 76.2 – – – 
T3 Salybia river 187.6 – – – 
T4 Salybia river mouth 157.8 – – – – 
T5 Salybia bay 74.2 – – – – 
T6 Balandra Bay Site One 43.2 – – – 
T7 Balandra Bay Site Two 46.6 – – – – 
T8 Rampalanagas beach 387.4 – – 
T9 Toco Bay Site One 72.6 – – 
T10 Toco Bay Site Two 106.8 – – – 
T11 San Souci Bay Site One 110 – – – 
T12 San Souci Bay Site Two 105.4 – – – – 
T13 Missions Bay Site One 416.8 – – – 
T14 Missions Bay Site Two 387.2 – – – 
T15 Brickfield Fishing Bay 3,972.6 
T16 Brickfield River 4,839.2 
T17 Waterloo Sea 2,599.4 
T18 Orange Valley Fishing Bay 2,406.6 
T19 Carli Bay 541.2 – 
T20 Caroni Swamp Boat Dock Site One 784.4 
T21 Caroni Swamp Site Two 1,072.8 
T22 Maracas River 240.5 
T23 Maracas River Mouth 312.3 
T24 Maracas Beach Site One 191.8 – – – 
T25 Maracas Beach Site Two 180.9 – – – 
T26 Tyrico Bay 60.4 – – – – 
T27 Las Cuevas Bay Site One 277.8 
T28 Las Cuevas Bay Site Two 322.3 
T29 La Fillette Beach 472.1 – – – – 
T30 Blanchisseuse Beach 243.6 – – 
T31 Yara River 2,419.6 – – 
T32 Macqueripe Bay 170.8 –  – – SU 
T33 Chaguaramas Bay TTYSA Site One 1,921.2 – SU 
T34 Chaguarama Bay TTYSA Site Two NA – – SU
SU 
T35 Chaguaramas Bay Boardwalk Site One 629.4 SU 
T36 Chaguaramas Bay Boardwalk Site Two 601.5 – SU 
T37 Williams Bay 550.4 – SU 
T38 Manzanilla ‘Le Branche’ River Mouth 231 – – 
T39 Manzanilla Fishing Bay 189.4 – – – – 
T40 Manzanilla Boardwalk 143.7 – – 
T41 Nariva River Mouth 103.1 – 
T42 Ortoire River Mouth 181.1 – – 
T43 Ortoire River Lower Course 169.1 – – – 
T44 Guayaguayare River 281.2 – – 
T45 Guayaguayare Beach/Industrial 150.6 – – – – 
T46 Guayaguayare Sea Wall 115.9 – – 
T47 Guayaguayare Fishing Depot 689.3 – – 
T48 Mayaro Beach Site One 59.5 – – – 
T49 Mayaro Beach Site Two 65.2 – – – – 
T50 Mafeking Bridge/Ortoire River Middle Course 381.1 – – – 
T51 Morne Diablo Beach 62.3 – – 
T52 Quinam Beach Site One 396.8 – 
T53 Quinam Beach Site Two NA – – 
T54 Oropouche/Godineau River 574.8 – – 
T55 Mosquito Creek River Mouth/Godineau Site One 629.4 – 
T56 Mosquito Creek Site Two 960.6 – 
T57 Mosquito Creek Site Three 1,011.2 – 
T58 Kings Warf San Fernando 1,149.6 – – 

R: rural, SU: suburban, U: urban.

A positive (+) detection was based on if any sample or its replicate had a threshold above the limit of detection determined by the standard curve of the assay.

MST: The PCR assay CP1 for Clostridium tetani of the avian (chicken and other birds) origin indicated that birds were the most common source (65.52%) of fecal pollution to water systems on the island. The chicken-specific marker (CP29F/R) suggested that over half of the sites (32.38%) impacted by bird fecal pollution contained chicken fecal bacteria (Table 2). The highest concentration of fecal pollution from avian sources was detected along the western coast of Trinidad. Human fecal Bacteroidales (HF-183) pollution was detected at 63.8% of the sites and was more predominant along the western region of the island. Similar trends were found for cattle BacCow at (34.48%) sites (Table 2). In addition, over 20% of the sampling areas along the island were impacted by human, avian and ruminant fecal pollution, and at 12% (7 sites), the MST assays used did not detect any human or animal sources of fecal pollution.

DISCUSSION

The concentration of FIB (i.e. E. coli) is widely used as an indicator to characterize the degree and potential health risk of fecal pollution found in aquatic environments (Bachoon et al. 2010). However, studies in tropical water systems have suggested that FIB may not always originate from fecal sources (Santo-Domingo et al. 1989). In spite of these reports, researchers and regulatory agencies in the tropics continue to use FIB concentrations for monitoring or detecting fecal pollution. Previous research in Trinidad has indicated varying levels of marine and freshwater quality with many popular beaches, including Maracas Bay, exhibiting unsafe levels of FIB, while other rivers and beaches on the island have relatively low levels of fecal bacteria (Bachoon et al. 2010; EMA 2011; IMA 2016). Quantitative E. coli results (Table 2) from the current study show that the water samples from most beaches along the north and eastern coast of the island, including Maracas, Las Cuevas and Tyrico Beach, had relatively low (<200 MPN 100 ml−1) or safe levels (USEPA 2012) of fecal pollution for recreational use. This may be attributed to the low density of human development and the lack of large-scale animal farming activity or significant crop production involving the use of animal manure in the northern range of the island. In contrast, high levels of E. coli (>400 MPN 100 ml−1) were detected at 22 sites; the majority of these sites were concentrated along the western coast where there is high density of human population along with activities such as fishing and farming of chicken, cattle or goats and field vegetable production with the use of cattle or chicken manure (Figure 1). Furthermore, many of the homes in Waterloo, Brickfield and Orange Valley fishing bays have outhouses and outdated septic systems. Previous FIB monitoring in the central region of Trinidad detected high levels (>1,600 CFU ml−1) of E. coli at Cali Bay (Bachoon et al. 2010; Walker et al. 2013). Another sampling area with high levels of E. coli was in the Caroni swamp. This is not surprising because the Caroni swamp is a national bird sanctuary surrounded by agricultural and residential activities. This finding is consistent with previous studies that documented high levels of E. coli ( > 3,000 CFU ml−1) in this area (Bachoon et al. 2010; Walker et al. 2013). At sites such as Chaguaramas Bay and Kings Wharf with high levels of E. coli but no animal farming or wildlife habitats, human fecal bacteria are the likely source of the pollution. Unfortunately, due to limited sample collection, we were not able to conduct a more extensive or seasonal sampling regime of fecal pollution on the island.

In marine and freshwater systems, human fecal pollution is considered to carry a higher public health risk than contamination originating from non-human fecal sources (Holman et al. 2014; Bradshaw et al. 2016). The HF-183 PCR assay for human fecal pollution is widely accepted as a reliable and sensitive PCR assay for the detection of human fecal bacteria contamination (Bernard & Field 2000; Krentz et al. 2013). It was alarming that >63% of the sites had detectable levels of human fecal (HF-183) contamination, including North Coast (6), North East (7), Central/West Coast (6), East Coast (4) and all sites in the south of the island (Table 2). Carli Bay was the only site in the Central/West sampling area that was not contaminated with human fecal pollution. This was surprising because Bachoon et al. (2010) detected human fecal pollution at Carli Bay using the Hubac marker. It is possible that the detection of human fecal pollution using the Bacteroidales Hubac assay in 2010 was caused by nonspecific amplification of non-human fecal bacteria (Boehm et al. 2013). In addition, a recent study in Costa Rica indicated that the HF-183 assay was less than 100% specific at detecting human fecal pollution (Symonds et al. 2017). However, the absence of human fecal bacteria in Carli Bay could also be attributed to the recent addition of a public restroom facility at the site. The other regions of the island (Table 2) where human fecal pollution was detected were close to major cities such as Port of Spain in the north or from rural villages along the southern and eastern coastline. Eighteen of the sites with human fecal contamination exceeded 410 MPN ml−1 and would be considered unsafe for recreational use based on USEPA water quality standards (US EPA 2012). Fortunately, these 18 sites did not include any of the popular bathing beaches (Table 2).

Trinidad and Tobago is known for an extraordinary amount of bird species that include both resident and migrant inhabitants (Terborgh 1974; Juman et al. 2013). The island's avian population is estimated to be approximately 28.5 million birds mainly domestic chickens (Gallus domesticus allus domesticus) and Muscovy ducks (Carina moschata arina moschata) (Baboolal et al. 2012). Consequently, it was not surprising that approximately 67% of the sampling sites had bird fecal pollution (CP1), especially in the central region of the island where avian fecal bacteria were detected at all sites, including the Caroni swamp (Table 2). The high incident of avian fecal pollution is troubling, even though avian feces contribute less human pathogens than human feces because birds do harbor a wide range of zoonotic pathogens (Baboolal et al. 2012). Further analysis using the MST assay developed by Lu et al. (2007) indicated that chicken fecal pollution was present at 36% of the sites and was concentrated in the central region. In central Trinidad, many villagers rear poultry for domestic use and we observed several small-scale poultry meat shops in Brickfield village and Waterloo village. Many of the vegetable farmers in these areas use chicken manure to fertilize their crops which may constitute an additional source of pollution. A few of the beaches (Maracas, Las Cuevas and Toco Bay) in the northeastern region of the island were contaminated with avian fecal bacteria; however, the levels of E. coli at these beaches were relatively low (<400 MPN ml−1).

Along with human and birds, cattle/ruminants were expected to be a major source of fecal pollution in Trinidad because many people on the island rare domesticated goats, sheep and cattle. In addition, it is common practice to use cattle manure fertilizer for crop farming. The BacCow assay indicated that at least 34% of the sites contained fecal bacteria of cattle origin, and in general the incidence of cattle fecal pollution was concentrated in the central and western sites on the island. Symonds et al. (2017) found that the BacCow had high sensitivity (88%) at detecting cattle fecal pollution in Costa Rician samples but is prone to cross-reaction. Surprisingly, cattle fecal pollution was detected at Maracus River, Las Cuevas and Chaguaramas even though there were no noticeable cattle farms in these areas. Therefore, the detection of cattle fecal pollution at these sites could be attributed to run-off of cattle manure that is widely used in food-crop production in the island. It should be noted that the cattle fecal bacteria marker (BacCow) used in this study has been reported to cross-react with fecal bacteria from other ruminant sources, including deer (Boehm et al. 2013). However, deer was not present or common at any of the sampling areas used in this study.

CONCLUSION

The high incident of fecal pollution of water bodies in Trinidad associated with human and bird fecal pollution is particularly alarming and represents a serious public health risk on the island. MST is a promising tool that can be applied to water quality surveys in Trinidad and other islands of the Caribbean to develop appropriate water monitoring and management steps on these islands. Future studies should monitor fecal pollution and use MST technology over a longer time scale to improve the evaluation of fecal pollution in Trinidad.

ACKNOWLEDGEMENT

This project was supported by Georgia College and State University and by research funds from the Georgia Power Endowment.

CONFLICT OF INTEREST

No conflict of interest declared.

REFERENCES

Alleng
G. P.
2007
Coastal Wetlands in Trinidad and Tobago Status and Trends
.
Institute of Marine Affairs
.
Amador
J. A.
Sotomayor-Ramírez
D.
Martínez
G.
Chen
L.
Bachoon
D.
2008
Tracking human faecal contamination in tropical reservoirs in Puerto Rico
.
Lakes & Reservoirs: Research and Management
13
,
301
317
.
Baboolal
V.
Suratsingh
V.
Gyan
L.
Brown
G.
Offiah
N. V.
Adesiyun
A. A.
Basu
A. K.
2012
The prevalence of intestinal helminths in broiler chickens in Trinidad
.
Veterinarski Arhiv
82
,
591
597
.
Bachoon
D. S.
Miller
C. M.
Green
C. P.
Otero
E.
2010
Comparison of four polymerase chain reaction methods for the rapid detection of human fecal pollution in marine and inland waters
.
International Journal of Microbiology
2010
,
1
7
.
Boehm
A. B.
Van De Werfhorst
L. C.
Griffith
J. F.
Holden
P. A.
Jay
J. A.
Shanks
O. C.
Wang
D.
Weisberg
S. B.
2013
Performance of forty-one microbial source tracking methods: a twenty-seven lab evaluation study
.
Water Research
47
,
6812
6828
.
Bustin
S. A.
Benes
V.
Garson
J. A.
Hellemans
J.
Huggett
J.
Kubista
M.
Mueller
R.
Nolan
T.
Pfaffl
M. W.
Shipley
G. L.
Vandesompele
J.
2009
The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments
.
Clinical Chemistry
55
(
4
),
611
622
.
Dick
L. K.
Stelzer
E. A.
Bertke
E. E.
Fong
D. L.
Stoeckel
D. M.
2010
Relative decay of Bacteroidales microbial source tracking markers and cultivated Escherichia coli in freshwater microcosms
.
Applied and Environmental Microbiology
76
,
3255
3262
.
Environment Management Association
2011
State of the Environment Report
.
Hernandez
C.
Ryu
H.
Gonzalez-Nieves
J.
Huertas
E.
Toranzos
G. A.
Santo Domingo
J. W.
2013
Tracking the primary sources of fecal pollution in a tropical watershed in a one-year study
.
Applied and Environmental Microbiology
79
,
1689
1696
.
Holman
C. B.
Bachoon
D. S.
Otero
E.
Ramsubhag
A.
2014
Detection of Helicobacter pylori in the coastal waters of Georgia, Puerto Rico and Trinidad
.
Marine Pollution Bulletin
79
,
354
358
.
Institute of Marine Affairs (IMA)
2016
State of the Marine Environment Trinidad and Tobago
.
Krentz
C. A.
Prystajecky
N.
Isaac-Renton
J.
2013
Identification of fecal contamination sources in water using host-associated markers
.
Canadian Journal of Microbiology
59
(
3
),
210
.
Palmer
C. J.
Tsai
Y. L.
Lang
A. L.
Sangermano
L. R.
1993
Evaluation of Colilert-marine water for detection of total coliforms and Escherichia coli in the marine environment
.
Applied and Environmental Microbiology
59
,
786
.
Rampersad
F. S.
Laloo
S.
La Borde
A.
Maharaj
K.
Sookhai
L.
Teelucksingh
J.
Adesiyun
A. A.
1999
Microbial quality of oysters sold in Western Trinidad and potential health risk to consumers
.
Epidemiology and Infection
123
,
241
250
.
Sinigalliano
C. D.
Gidley
M. L.
Shibata
T.
Whitman
D.
Dixon
T. H.
Laws
E.
Hou
A.
Bachoon
D.
Brand
L.
Amaral-Zettler
L.
Gast
R. J.
Steward
G. F.
Nigro
O. D.
Fujioka
R.
Betancourt
W. Q.
Vithanage
G.
Mathews
J.
Fleming
L. E.
Solo-Gabriele
H. M.
2007
Impacts of Hurricanes Katrina and Rita on the microbial landscape of the New Orleans area
.
Proceedings of the National Academy of Sciences of the United States of America
104
,
9029
9034
.
Staley
Z. R.
Chase
E.
Mitraki
C.
Crisman
T. L.
Harwood
V. J.
2013
Microbial water quality in freshwater lakes with different land use
.
Journal of Applied Microbiology
115
,
1240
1250
.
Symonds
E. M.
Young
S.
Verbyla
M. E.
McQuaig-Ulrich
S. M.
Ross
E.
Jimenez
J. A.
Harwood
V. J.
Breitbart
M.
2017
Microbial source tracking in shellfish harvesting waters in the Gulf of Nicoya, Costa Rica
.
Water Research
111
,
177
184
.
U.S. Environmental Protection Agency
1986
Ambient Water Quality Criteria for Bacteria – 1986
.
EPA 440/5-84/002. Criteria and Standards Division
.
US Environmental Protection Agency
,
Washington, DC
.
U.S. Environmental Protection Agency
2006
Total Coliform Rule: A Handbook for Small Noncommunity Water Systems Serving Less Than 3,300 Persons
. .
U.S. Environmental Protection Agency
2007
Carson River: Total Maximum Daily Loads for TSS and Turbidity
.
U.S. Environmental Protection Agency
2012
2012 Recreational Water Quality Criteria
. .
Walker
T. J.
Bachoon
D. S.
Otero
E.
Ramsubhag
A.
2013
Detection of verotoxin producing Escherichia coli in marine environments of the Caribbean
.
Marine Pollution Bulletin
76
,
406
410
.
Zhang
Q.
Gallard
J.
Wu
B.
Harwood
V. J.
Sadowsky
M. J.
Hamilton
K. A.
Ahmedg
W.
2019
Synergy between quantitative microbial source tracking (qMST) and quantitative microbial risk assessment (QMRA): a review and prospectus
.
Environment International
130
,
1
10
.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Licence (CC BY 4.0), which permits copying, adaptation and redistribution, provided the original work is properly cited (http://creativecommons.org/licenses/by/4.0/).