Occurrence of coliforms and biofilm-forming bacteria in raw, treated, and distributed water from two waterwork systems in Osun State, Southwestern Nigeria

Water supplies in underdeveloped nations are still insufficiently treated, forcing communities to rely on the most available sources (Sobsey 2002; Moyo et al. 2004). Many of these water sources are unprotected and vulnerable to contamination from runoff, windblown debris, human and animal faeces, and filthy collecting methods (Chidavaenzi et al. 1998; WHO 2000; Moyo et al. 2004). The quantity of microorganisms present in drinkable water influences its microbiological quality. However, because detecting each pathogenic organism in water is technically difficult, time-consuming, and expensive, it is not employed for routine water testing processes (Grabow 1996). As a result, indicator organisms are commonly used to assess the microbiological quality of water and provide a simple, quick, and reliable indication of water supply quality (Grabow 1996). Coliforms are members of the family Enterobacteriaceae and are defined as facultative anaerobic, Gram-negative, non-sporing, rod-shaped bacteria that ferment lactose with gas formation within 48 h at 35 °C (Prescott et al. 1999). Heterotrophic plate counts, total coliform bacteria (TCB), faecal coliform bacteria, and faecal Enterococci are utilized as a system indicator in water quality investigations, providing information on the efficacy of water treatment (APHA 1995; WHO 2000). The presence of coliforms in water samples indicates the existence of opportunistic pathogenic bacteria like Klebsiella and Enterobacter that can multiply in water environments, as well as pathogenic bacteria like Salmonella spp., Shigella spp., and Escherichia coli. These groups of microorganisms have the potential to cause illnesses such as gastroenteritis, dysentery, cholera, typhoid fever, and salmonellosis in consumers of these water sources (DWAF 1996; Grabow 1996). Biofilms can be found in industrial settings, hotels, wastewater channels, toilets, laboratories, and medical settings, and they typically form on hard surfaces that are submerged in or exposed to aqueous solutions. They can form on living and non-living surfaces (Rao et al. 2005).

Drinking water networks may be considered as biological reactors hosting a wide variety of microorganisms, such as bacteria, protozoa, and fungi, both in bulk water and on the surfaces of pipes. The Gram-negative bacteria predominate over the Gram-positive bacteria, and Pseudomonas is the most prevalent bacterial organism in water supply systems, regardless of the source. In microbial ecology, the rRNA-targeted oligonucleotide samples are identified and increasingly used to classify the bacterial species found in biofilms produced in water delivery systems (Wagner et al. 1993; Kalmbach et al. 1997; Ludmány et al. 2006). There have been several investigations on the existence and significance of biofilms in drinking water distribution systems (Momba et al. 1999; Gouider et al. 2009; Paris et al. 2009). Flemming et al. (2002) proposed that 95% of the bacteria would adhere to the pipeline surface and that only 5% would be present in the bulk water. Biofilm can protect microorganisms from various stress conditions and disinfectants. Biofilm also provides the injured microorganisms with the micro- and macro-nutrients needed for recovery and growth (Davey & O'Toole 2000). Chlorine, a potent oxidizing agent, is the disinfectant most widely used in water distribution systems because of its effectiveness, stability, simple to use, and affordability. In iron pipes, however, doses of chlorine as high as 4 mg/L have little impact on biofilm reduction as iron corrosion products interfere with free chlorine disinfection. The demand for chlorine in iron pipes was found to be as much as ten times higher than in pipes of a different composition.

Ede-Erinle and Opa reservoirs are land-treated surface water sources, which supply potable water to about 10 respective Local Government Areas in Osun State and the Obafemi Awolowo University Campus, Ile-Ife, Nigeria. This work was carried out to identify coliforms as well as the presence of biofilm-forming bacteria in water samples from the waterworks stations with a view to determining the potability of distributed water from these reservoirs, thereby enhancing the actualization of sustainable development (SDG) goal 6 (provision of clean water and sanitation) in this region of the Sub-Sahara Africa.

The operating procedures in both water treatment plants are the same. A low lift machine draws raw water from the reservoir to the aerator, where dosing pumps deliver aluminium sulphate, lime, and hypochlorite into the water. The water then enters the clarifier chamber, where it undergoes flocculation and/or coagulation (alum reacts with and traps dirt in the water). Clear water will float to the top, while flocs will sink to the bottom. The water is then directed to the filter bed, where filter media is used to catch the suspended particles that escape from the clarifier, allowing clean water to percolate to a conserved region for further processing. Following that, some underground pipes will transport the water from the point of percolation to the final destination, which is the clear well tank or the main reservoir, where water is stored underground for later distribution to the general public. Before the final water is routed to the clear water tank, a process known as post-chlorination is performed to maintain a specified level of chlorine in the water.

Eighteen sampling stations were established for this study. Nine sampling stations were selected for each of the two waterworks investigated. Water samples were taken from the reservoirs (raw water; ED1, OP1), the treatment stages (treated water; ED2, ED3, ED4, ED8, OP2, OP3, OP4, OP5), and at the final consumer taps (distribution water; ED5, ED6, ED7, ED9, OP6, OP7, OP8, OP9). Water samplings were carried out in the morning (between 7.00 am and 10.00 am) bi-monthly and covered both the dry and rainy seasons for two annual cycles between August 2017 and June 2019.

A total of 108 water samples were collected from each sampling station (raw water – 12 samples; treated water – 48 samples; distribution water – 48 samples) of the two waterwork systems in 500-mL sterile corked bottles. Each sample after the collection was placed in an ice box prior to its immediate transfer to the laboratory within the holding period of 6 h for bacteriological analyses, which include heterotrophic plate count, total coliform count, faecal coliform count using the pour plate method, and most probable number (MPN) of the coliform presumptive test.

Enumeration of total heterotrophic bacteria (THB) and TCB was carried out using serial dilution technique by introducing 1 mL of water samples into 10⁻² to 10⁻⁵ dilution folds and plated on sterile Petri dishes containing appropriately sterilized nutrient and MacConkey agar, respectively. The plates were then incubated at 37°C for 24 h, after which the colonies were counted using a manual colony counter.

The MPN of the coliform presumptive test was carried out on the water samples by placing three portions in each of three dilutions in geometric series employing the use of sterile single- and double-strength Lactose broth. For the dilution, a set of three test tubes, each containing 10 mL double-strength broth, and two sets of three test tubes, each containing 5 mL of sterile single-strength broth, were utilized. Ten millilitres of the sample was inoculated into each tube of the double-strength broth; 1.0 mL of the sample was inoculated into each of the first set of the three single-strength tubes, while 0.1 mL of the sample was inoculated into each of the other three single-strength broth. The culture tubes were incubated at 35 °C for 48 h, and each tube was observed for growth with acid and gas production. A tube in which acid and gas were produced was referred to as ‘a positive tube’. The combined number of positive tubes in each set arranged in order of least diluted to the most diluted tubes was read out from the appropriate standard MPN table to obtain the estimated number of coliform cells present in 100 mL of the original sample.

Bacterial isolates obtained were preliminarily identified using cultural, morphological, and biochemical tests. Probable identification of bacteria in the water samples was carried out using Bergey's Manual of Determinative Bacteriology (Holt et al. 1994).

Phenotypic investigation for biofilm production by the isolates was performed using Congo Red Agar Medium, which was prepared using the combination of brain heart infusion agar 52 g/L, sucrose 50 g/L, and Congo red indicator 0.8 g/L, as described by Mathur et al. (2006). The Congo red was prepared as a concentrated aqueous solution separately from other medium constituents and then sterilized in different containers before adding them together when the agar had cooled to 55 °C before being distributed to sterile plates to solidify. The plates were then inoculated with the test organisms using point inoculation method and incubated at 37 °C for 24 h. The presence of black colonies on the positive plates, characterized by a dry crystalline quality, signifies the formation of biofilm.

Molecular DNA extraction from the bacterial isolates was carried out using the boiling technique, as described by Gueimonde et al. (2004) and Naas et al. (2007). In further determining the identities of bacterial species isolated, polymerase chain reaction (PCR) was used by employing bacterial-specific universal primers. The primer developed by Horakova et al. (2008) amplified at 1465-bp sequence of 16srRNA gene was used as follows: 27F 5′-AGAGTTTGATCCTGGCTCAG–3′ and 1429R 5′-GGTTACCTTGTTACGACTT-3′. The reaction mixture contained 12.5 μL of PCR Master Mix (New England Biolabs, SA), 0.5 μL each of Forward and Reverse Primers (Inqaba Biotech, SA), 3 μL of DNA template, and 8.5 μL of nuclease-free water to constitute a total reaction volume of 25 μL. The PCR conditions for the detection of 16S rRNA genes of the bacterial species were as described by Horakova et al. (2008) but with slight modification. Gene amplification was carried out in an Applied Biosystems 2720 Thermal Cycler. The mixture was subjected to an initial denaturation at 94 °C for 5 min, followed by denaturation at 94 °C for 1 min, annealing at 48 °C for 30 s, extension at 72 °C for 1 min for 37 times, and final extension step at 72 °C for 10 min. For the identification of biofilm-producing bacteria, the following two sets of primers were utilized: (i) bcsA-F GCT TCT CGG CGC TAA TGT TG; bcsA-R GAG GTA TAG CCA CGA CGGTG (826 bp), as described by Olowe et al. (2019), and (ii) BssS-F GATTCAATTTTGGCGATTCCTGC; BssS-R TAATGAAGTCATTCAGACTCATCC (225 bp), as described by Hassan & Abdalhamid (2014). The conditions for the forward and reverse biofilm primers were initial denaturation at 94 °C for 2 min followed by 40 s of denaturation also at 94 °C, annealing at 48 °C for 1 min, extension at 72 °C for 1 min for 35 times, and final extension step at 72 °C for 5 min.

Electrophoresis was done by loading 10 μL aliquot of the amplicons on 1.5% agarose gel CSL-AG 100 (Cleaver Scientific Ltd, SA) stained with 5 μL ethidium bromide (Sigma-Aldrich, USA) and ran in 1X TAE buffer (tri-acetate EDTA buffer) (BioConcept, SA) for 1 h at 80 V. The PCR fragments were visualized with a UV transilluminator (Uvitec 07 10322). The 16S rRNA PCR products were sequenced using the Nimagen, Brilliant-Dye™ Terminator Cycle Sequencing Kit V3.1, BRD3-100/1000 according to the manufacturer's instructions. Sequence chromatogram analysis was performed using Finch TV analysis software version 1.4.0. All nucleotide sequences obtained were analysed by a BLAST search (http://www.ncbi.nlm.nih.gov/BLAST).

The acquired data were analysed using descriptive, inferential (ANOVA), and multivariate (cluster analysis) statistics with applicable statistical software such as PAST version 2.17 and SPSS version 20. The student sample t-test (p < 0.05) was used to compare the bacteriological quality of the two reservoir systems to the World Health Organization (WHO) and Nigerian Standard for Drinking Water Quality (NSDWQ) permitted standards.

In Ede-Erinle reservoir, THB over the period of study ranged from 0 to 1.30 × 10⁶ CFU/mL, with overall mean and median values of 1.54 × 10⁵ and 1 × 10⁵ CFU/mL, respectively (Table 2), whereas total coliform bacteria counts (TCBC) in water samples collected from Ede-Erinle reservoir over the study period ranged from 0 to 1.1 × 10³ CFU/mL, with overall mean and median values of 182.23 ± 33.91 CFU/mL and 10 CFU/mL, respectively (Table 2). Across the stations, the highest THB mean value of 3.94 × 10⁵ ± 1.1 × 10⁵ CFU/mL was recorded in the raw water station, while the lowest mean value of 9.61 × 10⁴ ± 1.50 × 10⁴ CFU/mL was recorded at the distributed water station. However, there was a significant spatial difference (p < 0.001) across the stations. The highest TCBC mean value was recorded at the raw water station (9.67 × 10² ± 7.0 × 10¹ CFU/mL), while the lowest mean value occurred at the distributed water stations (69.56 ± 26.81 CFU/mL). In general, the mean values of TCBC across the stations were significantly different (p < 0.001) from each other (Table 2). The THB count was higher in the rainy season than in the dry season, but the seasonal mean values were not significantly different from each other (p > 0.05) (Table 3). Meanwhile, the TCBC was generally higher in the dry season than in the rainy season, but there was no significant difference (p > 0.05) between the two seasonal mean values (Table 3). The total heterotrophic bacteria count (THBC) in the Opa waterworks system ranged from 0 to 3.10 × 10⁷ CFU/mL, with an overall mean of 4.91 × 10⁵ ± 2.9 × 10⁵ CFU/mL and median of 5.0 × 10³ (Table 2). TCBC ranged from 0 to 1.1 × 10² CFU/mL, with overall mean and median values of 3.9 × 10² ± 4.5 × 10¹ CFU/mL and 93.00 CFU/mL, respectively (Table 2). The highest THB mean value of 3.31 × 10⁶± 2.57 × 10⁶ CFU/mL was recorded in the raw water, while the lowest mean value of 9.58 × 10⁴ ± 2.55 × 10⁴ CFU /mL occurred at the distributed water station. The highest mean TCBC value (723.00 ± 129.28 CFU/mL) was recorded at the raw water station, while the lowest mean value (142.94 ± 44.41 CFU/mL) occurred at the distributed water station. The difference in mean values across stations was significant at p < 0.001 (Table 2). The THB abundance was higher in the dry season than in the rainy season, but the seasonal mean values were not significantly different from each other (p > 0.05) (Table 3). Whereas TCBC was higher during the rainy season (458.40 ± 55.75 CFU/mL) than in the dry season (242.58 ± 95.66 CFU/mL), and there was a significant difference (p < 0.05) between the two seasonal mean values (Table 3).

The biochemical characteristics and probable bacterial isolates identified during this study from Ede-Erinle and Opa water samples are presented in Table 5.

The biochemical characteristics and probable bacterial isolates identified during this study from Ede-Erinle and Opa water samples are presented in Table 5.

Water pollution happens when particles, chemicals, or bacteria invade a water supply. Some of the major causes of water contamination are agricultural runoff, industrial contamination, insufficiently treated water, natural catastrophes, and sewage leaks. Although it is reasonable to assume the presence of certain contaminants in drinking water because pure unpolluted water does not occur in nature, some contaminants in drinking water may be dangerous if ingested in certain quantities. Also, the presence of these contaminants in water may lead to biofilm formation. In this study, THBC and TCBC exceeded the NSDWQ (2015) and WHO (2017) permissible limit for drinking water standards in the stations of Ede-Erinle and Opa waterwork systems, notably at the distribution water stations. This poses a significant threat to the health of consumers of these water supplies in the region. Also, a higher population of bacterial species was isolated in the rainy season than in the dry season in the Ede-Erinle and Opa waterwork systems. This could be attributed to the discharge and washing of organic matter into the water bodies, which promotes the proliferation of these bacterial species. This was consistent with the findings of many researchers (Ogbonna 2010; Oluyege et al. 2011; Adesoji & Ogunjobi 2013; Balogun et al. 2013) who hypothesized that the presence of a greater number of heterotrophic bacterial species in rivers and other sources of drinking water during the wet season compared to the dry season could be due to favourable physicochemical conditions, which could be attributed to the presence of allochthonous materials from the catchment area of the river during the rainy season.

High microbial loads (higher than the WHO permissible limits for heterotrophic and coliform bacteria in any water meant for drinking) documented at the distribution stations of the two waterwork systems despite treatment may be due to leakage as observed during the collection of samples in the pipelines at some distribution channels. Leakage in pipe water transmission pipelines might have enabled pollutants to reach the water transmission line. This is analogous to the observation of Van Zyl (2004) that there is a renewed international concern that water delivery systems are ageing and decaying worldwide, as the demands on these systems, and thus on our natural water supplies, are growing. In several towns and cities around the world, non-revenue water in water delivery systems is reaching alarming levels. In their findings, the United Nations (2002) and Hall (2006) stated that about half of the water in the drinking water supply systems in the developing world is lost due to leakage, illegal hook-ups, and vandalism that could eventually lead to poor microbial quality water production and eventually to a public health crisis. Another possible explanation for this could be that the disinfectants used or their dose might be bacteriostatic and not effective enough to completely eliminate the microbes. This can trigger the static microbes to reactivate a few days after disinfection. Another reason may also be the lack of adequate residual chlorine in some of the treated water being pumped out into the various distribution stations of Ede-Erinle and Opa waterwork systems.

The presence of P. aeruginosa and other genera of Enterobacteriaceae (coliforms) such as E. coli (faecal coliform), especially in the Opa waterworks system, is an indication that the water sources are of poor microbiological quality. The presence of these coliforms and non-coliform pathogenic bacteria in the Ede-Erinle and Opa waterwork systems over the two seasons considered in the course of this study could have consequential health effects on the final consumer of the water sources. P. aeruginosa and other genera of Enterobacteriaceae are associated with gastroenteritis (Adeniyi & Olabanji 2005). A few strains of E. coli have been implicated to cause diarrhoea and kidney failure (Karch et al. 2005). K. pneumoniae are important causes of different bacterial infections such as bacteraemia, respiratory and urinary tract infections, neonatal meningitis, and pneumonia (Vasaikar et al. 2017).

The molecular identification of B. pseudomycoides, a bacterium generally known to be found in the soil worldwide in the reservoir station of the Ede-Erinle waterworks system, could be a result of erosion or runoff of sub-surface soil into the water body. The bacterial species may also have found their way into the water body from the bottom sediments of the reservoir. Similarly, P. stutzeri, a common clinical isolate that was identified in the Ede-Erinle reservoir water station, might be a result of runoff from hospital wastes or urines from humans and animals into water bodies, which could find their way into the reservoir. The isolation of A. jandaei from the distribution station in the Fajuyi Hall of Opa waterwork systems was in agreement with the work of Kühn et al. (1997), who reported the presence of A. jandaei from a drinking water distribution system in Sweden. This bacteria is capable of producing toxins, which could be harmful to the consumers of the distributed water. The isolation of P. rettgeri and M. morganii from the Staff Club distribution station and Staff Quarters distribution station of the Opa waterworks system, respectively, could cause a wide variety of human infections in the consumer of water from this station without prior treatment. This may range from urinary tract infections to gastroenteritis and bacteraemia (O'Hara et al. 2000). P. rettgeri has previously been isolated from poultry, reptile and amphibian faeces, and surface waters. It is only sometimes isolated from human faeces and the urinary tract. The bacterium generates urease, which causes urine alkalinization and catheter encrustation. Wounds, burns, and blood infection have also been linked to P. rettgeri (Traub et al. 1971; Kaslow et al. 1976; Müller 1986; Yoh et al. 2005). Bacterial biofilm formation and subsequent resistance to antibiotics and disinfectants is a slow but substantial hazard to human health. Biofilm production has become a common occurrence not just in human and animal illnesses but also in non-biological settings. The biofilm-forming bacteria recorded at distribution stations of the Ede-Erinle and Opa waterworks could be attributed to treatment processes or distribution infrastructure deficiencies, as suggested by Lehtola et al. (2004).

Molecular identification of bacteria complements the phenotypic methods, as conventional biochemical identification methods have been shown to be insufficient in the identification of bacterial isolates to species level; hence, to avoid misidentification of such isolates, molecular identification is more reliable.

The study concluded that the identification of coliform bacteria in the treated and distributed water sources of the two waterwork systems, most especially the isolation of E. coli and K. pneumoniae at the Opa distributed water station, is an indication of faecal pollution. This could pose a high health risk to the consumers of these water sources without further treatment before use. The presence of biofilm-forming bacteria in the distributed water from these waterwork systems may compromise the efficacy of water treatment operations. It could also lead to the evolution of antibiotic-resistance genes in aquatic bacteria, making treatment harder for affected consumers of these water sources.

All relevant data are included in the paper or its Supplementary Information.

The authors declare there is no conflict.