Abstract

This study examined the occurrence and molecular basis for antibiotic-resistant staphylococci from the wastewater treatment plant and grey-water samples in Obafemi Awolowo University, Nigeria. Standard microbiological techniques and molecular methods were utilized. The species identified (MALDI score >1.7) comprised S. saprophyticus (19), S. cohnii (8), S. sciuri (7), S. aureus (4), S. epidermidis (3), S. warneri (2), S. equorum (1), S. haemolyticus (1), S. nepalensis (1), S. condimenti (1), and S. pasteuri (1). Resistance to trimethoprim, tetracycline and cefoxitin were observed in 78.3% (47/60), 36.7% (22/60) and 25% (15/60) of the isolates, respectively. The rate of multidrug resistance was 53.3% (32/60) and observed in eight species from different sampling sites. Seven (S. sciuri; n = 5; S. aureus; n = 1; S. warneri; n = 1) of the 20 selected (representing the various staphylococcal species and antibiotypes) isolates were mecA-positive. Furthermore, the tetK gene was detected in nine isolates, six with dfrA, and four were positive for the dfrG gene. One S. aureus was mecA, tetK and dfrG gene positive. The study provides insights on antibiotic-resistant staphylococci from a non-clinical setting and highlights the need for active surveillance to understand the burden of antimicrobial resistance in Nigeria. This is key to improve synergy across the human, animal and environmental health sectors in Nigeria.

HIGHLIGHTS

  • The research provides information on the presence and species diversity of antibiotic-resistant staphylococci in wastewater treatment plant and grey-water in Ile-Ife, Nigeria.

  • The molecular basis for antibiotic resistance in staphylococci to methicillin, tetracycline and trimethoprim was reported in the study.

  • The study reports the development of a multiplex PCR procedure for the prompt detection of tetracycline and trimethoprim resistance genes in staphylococci.

  • The study highlights the need for active antimicrobial resistance surveillance to understand the burden of antimicrobial resistance in Nigeria.

  • In addition, the study highlights the need for synergistic approach between human, animal and environmental health in overcoming the fight against antimicrobial resistance in Nigeria using the ‘One-Health’ approach.

INTRODUCTION

Wastewater (including grey-water – household waste devoid of fecal matter) is an integral part of human activities. However, its indiscriminate discharge to various environmental receptors (stream/rivers, seas) has profound consequences on human health and ecosystems (Naidoo & Olaniran 2014). These adverse effects could be reduced by a combination of physicochemical and biological methods in wastewater treatment plants (WWTPs). These facilities are designed to mitigate the environmental and health hazards of polluted water, and make it suitable for various activities (Lood et al. 2017; Manaia et al. 2018). Despite these achievements, WWTPs are now widely regarded as hotspots for the development of antibiotic-resistant bacteria (ARB). This could be attributed to the presence of antibiotic residues at sub-lethal concentrations, the interaction of different bacterial species in the ecosystem, and horizontal gene transfer events (Manaia et al. 2018). ARB, including methicillin-resistant Staphylococcus aureus (MRSA), an important human and animal pathogen, have been recovered from WWTPs (Borjesson et al. 2010; Goldstein et al. 2012; Gómez et al. 2016). In addition, antibiotic-resistant coagulase-negative staphylococci (CoNS) have also been detected in wastewater and WWTPs (Faria et al. 2009; Gómez et al. 2016). ARB and residual antibiotics have been reported from wastewater in Nigeria (Lateef et al. 2007; Adelowo et al. 2008; Oyetibo et al. 2010). These studies identified ARB (Lateef et al. 2007), including those exhibiting co-resistance with antiseptics (Adelowo et al. 2008), and heavy metal, for example cadmium, cobalt, nickel and mercury (Oyetibo et al. 2010). Moreover, recent data on extended-spectrum beta-lactamase (ESBL) producing bacteria and associated genes from untreated hospital wastewater (Adelowo et al. 2018) provide evidence that wastewater could be a potential reservoir for ARB. This portends a risk to public health as ARB and resistance genes could be disseminated through this medium to humans, animals and the environment. There is a paucity of data on antibiotic-resistant staphylococci from environmental samples including wastewater or WWTPs in Nigeria. This study examined the occurrence of antibiotic-resistant staphylococci and their resistance genes from the WWTP and grey-water samples in Obafemi Awolowo University (OAU), Ile-Ife, Nigeria.

Figure 1

Detection of the dfrA, dfrG, and tetK genes by multiplex PCR among staphylococcal isolates obtained from WWTP and grey-water samples.

Figure 1

Detection of the dfrA, dfrG, and tetK genes by multiplex PCR among staphylococcal isolates obtained from WWTP and grey-water samples.

METHODS

Sample collection and identification of staphylococci

Wastewater samples were collected from the Obafemi Awolowo University oxidation pond (inlet, pond and outlet), while grey-water samples were obtained from effluent points in three student halls of residence (Fajuyi Hall, Moremi Hall, and Postgraduate Hall) on the university campus. Grab samples (250 mL) were collected in sterile 500 mL bottles and transported immediately to the laboratory (in an icebox). Samples were collected every fortnight for a period of six months (June–November 2017). A series of ten-fold dilutions of the samples were performed, and 100 L of the sample was plated on mannitol salt agar (MSA) and incubated at 37 °C for 48 hours. Colonies (1–5 per sample) with typical morphology of staphylococci were selected from each MSA plate for subsequent investigations. Identification was carried out following standard microbiological techniques (Gram staining, catalase, coagulase, DNase and oxidase tests). This was followed by the matrix-assisted laser desorption/ionization-time of flight mass spectrometry (MALDI-TOF MS, Bruker, Dalton, Germany), using the identification threshold of 1.7 (Han et al. 2015). MALDI-TOF is a high throughput system that involves the generation of mass spectra from whole-cell material or extracted intracellular content which are then compared with a database reference (Angeletti 2016). The major advantages of MALDI-TOF MS compared with routine phenotypic methods include the quick and reliable identification of microbes.

Antibiotic susceptibility testing

Antibiotic susceptibility testing was carried out on staphylococcal isolates using the disk diffusion method. This was performed with 13 antibiotics: cefoxitin (30 g), chloramphenicol (30 g), clindamycin (2 g), ciprofloxacin (10 g), erythromycin (15 g), fusidic acid (10 g), gentamicin (10 g), mupirocin (5 and 200 μg), penicillin G (10 U), rifampicin (5 g), tetracycline (30 g), trimethoprim (5 g), and trimethoprim-sulfamethoxazole (1.25/23.75 g). The zones of inhibition were measured and interpreted using the guidelines of the Clinical and Laboratory Standard Institute (CLSI 2016). The breakpoint values of the British Standard for Antimicrobial Chemotherapy (BSAC 2011) were employed for fusidic acid and mupirocin. Multidrug resistance (MDR) was defined as resistance to at least three classes of antibiotics.

Detection of antibiotic resistance and virulence genes

The resistance genes for trimethoprim (dfrA and dfrG), methicillin (mecA), and tetracycline (tetK) were investigated by PCR based on the widespread use of these antibiotics (trimethoprim and tetracycline) and clinical importance (methicillin) in Nigeria. Twenty isolates were selected based on their antibiotypes and to represent the various staphylococcal species identified in the study. A multiplex PCR reaction was performed for the detection of staphylococcal protein A (spa), Panton–Valentine Leukocidin (PVL) and methicillin resistance (mecA) genes as previously described (Larsen et al. 2008). A uniplex PCR was performed for the detection of the dfrA, dfrG, and tetK genes (Ng et al. 2001; Argudín et al. 2011). Thereafter, a multiplex PCR was developed for the detection of the above-mentioned genes. The multiplex PCR conditions were as follows: initial denaturation at 94 °C for 5 minutes followed by 35 cycles of denaturation at 94 °C for 60 seconds, annealing at 54 °C for 60 seconds, and elongation at 72 °C for 60 seconds. The final extension was at 72 °C for 4 minutes. The primers for the detection of virulence and resistance genes are described in Table 1. The species confirmation (MALDI-TOF) and molecular characterization of the isolates were conducted at the Noguchi Memorial Institute for Medical Research, University of Ghana.

Table 1

Primers used for the study

GenesDescriptionPrimersAmplicon sizesReferences
mecA Methicillin resistance Forward: TCCAGATTACAACTTCACCAGG
Reverse: CCACTTCATATCTTGTAACG 
162 bp Larsen et al. (2008)  
PVL Panton-Valentine Leukocidin Forward: GCTGGACAAAACTTCTTGGAATAT
Reverse: GATAGGACACCAATAAATTCTGGATTG 
80 bp Larsen et al. (2008)  
dfrA Trimethoprim resistance Forward: CACTTGTAATGGCACGGAAA
Reverse: CGAATGTGTATGGTGGAAAG 
270 bp Argudín et al. (2011)  
dfrG Trimethoprim resistance Forward: TGCTGCGATGGATAAGAA
Reverse: TGGGCAAATACCTCATTCC 
405 bp Argudín et al. (2011)  
tetK Tetracycline resistance Forward: TCGATAGGAACAGCAGTA
Reverse: CAGCAGATCCTACTCCTT 
169 bp Ng et al. (2001)  
Spa Staphylococcal protein A Forward : TAAAGACGATCCTTCGGTGAGC
Reverse: CAGCAGTAGTGCCGTTTGCTT 
Variable Larsen et al. (2008)  
GenesDescriptionPrimersAmplicon sizesReferences
mecA Methicillin resistance Forward: TCCAGATTACAACTTCACCAGG
Reverse: CCACTTCATATCTTGTAACG 
162 bp Larsen et al. (2008)  
PVL Panton-Valentine Leukocidin Forward: GCTGGACAAAACTTCTTGGAATAT
Reverse: GATAGGACACCAATAAATTCTGGATTG 
80 bp Larsen et al. (2008)  
dfrA Trimethoprim resistance Forward: CACTTGTAATGGCACGGAAA
Reverse: CGAATGTGTATGGTGGAAAG 
270 bp Argudín et al. (2011)  
dfrG Trimethoprim resistance Forward: TGCTGCGATGGATAAGAA
Reverse: TGGGCAAATACCTCATTCC 
405 bp Argudín et al. (2011)  
tetK Tetracycline resistance Forward: TCGATAGGAACAGCAGTA
Reverse: CAGCAGATCCTACTCCTT 
169 bp Ng et al. (2001)  
Spa Staphylococcal protein A Forward : TAAAGACGATCCTTCGGTGAGC
Reverse: CAGCAGTAGTGCCGTTTGCTT 
Variable Larsen et al. (2008)  

RESULTS

Of the 72 wastewater/grey-water samples obtained in the study, 153 isolates from 43 samples (wastewater: n = 15; greywater: n = 28) were presumptively identified as staphylococci. For this baseline study, 60 isolates (WWTPs: n = 15, grey-water samples: Fajuyi Hall, n = 15; Moremi Hall, n = 15 and Post-Graduate Hall, n = 15) were selected for identification by MALDI-TOF MS to represent the various sampling sites. Overall, eleven staphylococcal species were noted with an identification score of >1.7. They comprised S. saprophyticus (19; 31.7%), S. cohnii (8; 13.3%), S. sciuri (7; 11.7%), S. aureus (4; 6.7%), S. epidermidis (3; 5%), S. warneri (2; 3.3%), S. equorum (1; 1.7%), S. haemolyticus (1; 1.7%), S. nepalensis (1; 1.7%), S. condimenti (1; 1.7%), and S. pasteuri (1; 1.7%). However, 12 (20%) of the 60 isolates gave an identification score of <1.7 (Supplementary material). Antibiotic susceptibility test results showed that all the 60 staphylococcal isolates were susceptible to mupirocin that is commonly used to treat staphylococcal skin infections. However, the proportion of isolates resistant to trimethoprim was >50% across all species except S. nepalensis and S. condimenti (Table 2). A total of 27 antibiotypes were identified and the two main groups consisted of the following: resistance to fusidic acid and trimethoprim (n = 12), and resistance to erythromycin, fusidic acid, cefoxitin, gentamicin, and trimethoprim (n = 6). MDR was recognized in eight species in various sampling sites (Supplementary material). They included S. saprophyticus (n = 8), S. cohnii (n = 5), S. equorum (n = 5), S. sciuri (n = 5), S. haemolyticus (n = 3), S. epidermidis (n = 3), S. capitis (n = 2), and S. aureus (n = 1). Overall, 15 staphylococcal isolates were resistant to cefoxitin of which 11 (73.3%) exhibited MDR. The major antibiotype, i.e. resistance to erythromycin, fusidic acid, cefoxitin, gentamicin, and trimethoprim, was noted in S. sciuri (n = 5) and S. epidermidis (n = 1).

Table 2

Antibiotic resistance of selected staphylococcal isolates obtained from wastewater and grey-water samples in Obafemi Awolowo University, Ile-Ife

Antibiotics (potency: g)Number of staphylococcal isolates that exhibited resistance (%)
S. saprophyticus (19)S. cohnii (8)S. sciuri (7)S. aureus (4)S. epidermidis (3)S. warneri (2)S. equorum (1)S. nepalensis (1)S. haemolyticus (1)S. pasteuri (1)S. condimenti (1)Low identity score (12)Total (60)
C (30 g) 5 (26.3) 2 (25) 1 (100) 1 (8.3) 9 (15) 
CD (2 g) 2 (28.6) 1 (33.3) 3 (5) 
CIP (10 g) 1 (12.5) 1 (25) 1 (33.3) 1 (8.3) 4 (6.7) 
E (15 g) 1 (5.3) 3 (37.5) 5 (71.4) 1 (33.3) 2 (16.7) 12 (20) 
FD (10 g) 19 (100) 8 (100) 7 (100) 1 (33.3) 1 (50) 1(100) 12 (100) 49 (81.7) 
FOX (30 g) 1 (5.3) 1 (12.5) 7 (100) 1 (25) 2 (66.7) 1 (100) 2 (16.7) 15 (25) 
GM (10 g) 5 (71.4) 1 (25) 2 (66.7) 8 (13.3) 
MUP (5 g) 
MUP (200 g) 
PG (10 U) 5 (26.3) 2 (25) 6 (85.7) 2 (50) 3 (100) 1 (100) 9 (75) 28 (46.7) 
RP (5 g) 1 (5.3) 1 (1.6) 
T (30 g) 5 (26.3) 4 (50) 1 (25) 1 (33.3) 1 (50) 1 (100) 1 (100) 8 (88.9) 22 (36.7) 
TM (5 g) 18 (94.7) 7 (87.5) 5 (71.4) 4 (100) 2 (66.7) 1 (50) 1 (100) 1 (100) 1 (100) 7 (77.8) 47 (78.3) 
TS (25 g) 16 (84.2) 3 (37.5) 3 (75) 1 (33.3) 1 (100) 1 (8.3) 25 (41.7) 
Antibiotics (potency: g)Number of staphylococcal isolates that exhibited resistance (%)
S. saprophyticus (19)S. cohnii (8)S. sciuri (7)S. aureus (4)S. epidermidis (3)S. warneri (2)S. equorum (1)S. nepalensis (1)S. haemolyticus (1)S. pasteuri (1)S. condimenti (1)Low identity score (12)Total (60)
C (30 g) 5 (26.3) 2 (25) 1 (100) 1 (8.3) 9 (15) 
CD (2 g) 2 (28.6) 1 (33.3) 3 (5) 
CIP (10 g) 1 (12.5) 1 (25) 1 (33.3) 1 (8.3) 4 (6.7) 
E (15 g) 1 (5.3) 3 (37.5) 5 (71.4) 1 (33.3) 2 (16.7) 12 (20) 
FD (10 g) 19 (100) 8 (100) 7 (100) 1 (33.3) 1 (50) 1(100) 12 (100) 49 (81.7) 
FOX (30 g) 1 (5.3) 1 (12.5) 7 (100) 1 (25) 2 (66.7) 1 (100) 2 (16.7) 15 (25) 
GM (10 g) 5 (71.4) 1 (25) 2 (66.7) 8 (13.3) 
MUP (5 g) 
MUP (200 g) 
PG (10 U) 5 (26.3) 2 (25) 6 (85.7) 2 (50) 3 (100) 1 (100) 9 (75) 28 (46.7) 
RP (5 g) 1 (5.3) 1 (1.6) 
T (30 g) 5 (26.3) 4 (50) 1 (25) 1 (33.3) 1 (50) 1 (100) 1 (100) 8 (88.9) 22 (36.7) 
TM (5 g) 18 (94.7) 7 (87.5) 5 (71.4) 4 (100) 2 (66.7) 1 (50) 1 (100) 1 (100) 1 (100) 7 (77.8) 47 (78.3) 
TS (25 g) 16 (84.2) 3 (37.5) 3 (75) 1 (33.3) 1 (100) 1 (8.3) 25 (41.7) 

Key – C: Chloramphenicol; CD: Clindamycin; CIP: Ciprofloxacin; E: Erythromycin; FD: Fusidic acid; FOX: Cefoxitin; GM: Gentamicin; MUP: Mupirocin; PG: Penicillin; RP: Rifampicin; T: Tetracycline; TM: Trimethoprim; TS: Trimethoprim-sulfamethoxazole. Values in bracket are percentages.

Of the 20 selected staphylococci, seven (S. sciuri (n = 5), S. aureus (n = 1) and S. warneri (n = 1)) were mecA positive. One methicillin-susceptible S. aureus (MSSA) was PVL positive (Table 3). Based on the multiplex PCR, nine of the 10 tetracycline-resistant isolates were positive for the tetK gene. The trimethoprim resistance (dfrG and dfrA) genes were detected in four and six isolates, respectively (Figure 1 and Supplementary material).

Table 3

Antibiotic resistance pattern and associated gene determinants in selected isolates

Sample codeSample siteIdentity of IsolatesAntibiotic resistance patternResistance genesVirulence gene (PVL)
Isolates obtained from wastewater samples OPI9E Oxidation pond (inlet) S. aureus TM (TM) dfrG 
OPI10C Oxidation pond (inlet) S. aureus CIP-GM-FOX-T-TM (FOX-T-TM) dfrG, mecA, tetK – 
OPP3A Oxidation pond (pond) S. sciuri E-FD-FOX-GM-TM (FOX-TM) mecA ND 
OPI4G Oxidation pond (inlet) S. sciuri E-FD-FOX-GM-TM (FOX-TM) mecA ND 
OPI8A Oxidation pond (inlet) S. sciuri E-FD-FOX-GM-TM (FOX-TM) mecA ND 
OPO5D Oxidation pond (outlet) S. saprophyticus C-FD-T-TM (T-TM) dfrG, tetK ND 
OPI8H Oxidation pond (inlet) S. pasteuri TM (TM) dfrA ND 
OPP8B Oxidation pond (pond) S. condimenti Susceptible to all – ND 
Isolates obtained from grey-water samples WWPG8F Postgraduate Hall S. sciuri E-FD-FOX-GM-TM (FOX-TM) mecA ND 
WWF8B Fajuyi Hall S. sciuri E-FD-FOX-GM-TM (FOX-TM) mecA ND 
WWM1B Moremi Hall S. saprophyticus C-FD-PG-RP-T-TM (T-TM) tetK ND 
WWF5D Fajuyi Hall S. saprophyticus FD-T-TM (T-TM) dfrA, tetK ND 
WWM8I Moremi Hall S. saprophyticus C-FD-T-TM (T-TM) dfrA, tetK ND 
WWPG8I Postgraduate Hall S. cohnii FD-T (T) tetK ND 
WWPG16E Postgraduate Hall S. cohnii FD-T-TM (T-TM) tetK ND 
WWF4F Fajuyi Hall S. epidermidis E-FD-FOX-GM-TM (FOX-TM) dfrA ND 
WWF10G Fajuyi Hall S. haemolyticus FOX-T-TM (FOX-T-TM) dfrG ND 
WWM4G Moremi Hall S. nepalensis C-T (T) tetK ND 
WWF8D Fajuyi Hall S. warneria TM (TM) dfrA, mecA ND 
WWF5B Fajuyi Hall S. equorum C- FD-FOX- T-TM- (FOX-T-TM) dfrA, tetK ND 
Sample codeSample siteIdentity of IsolatesAntibiotic resistance patternResistance genesVirulence gene (PVL)
Isolates obtained from wastewater samples OPI9E Oxidation pond (inlet) S. aureus TM (TM) dfrG 
OPI10C Oxidation pond (inlet) S. aureus CIP-GM-FOX-T-TM (FOX-T-TM) dfrG, mecA, tetK – 
OPP3A Oxidation pond (pond) S. sciuri E-FD-FOX-GM-TM (FOX-TM) mecA ND 
OPI4G Oxidation pond (inlet) S. sciuri E-FD-FOX-GM-TM (FOX-TM) mecA ND 
OPI8A Oxidation pond (inlet) S. sciuri E-FD-FOX-GM-TM (FOX-TM) mecA ND 
OPO5D Oxidation pond (outlet) S. saprophyticus C-FD-T-TM (T-TM) dfrG, tetK ND 
OPI8H Oxidation pond (inlet) S. pasteuri TM (TM) dfrA ND 
OPP8B Oxidation pond (pond) S. condimenti Susceptible to all – ND 
Isolates obtained from grey-water samples WWPG8F Postgraduate Hall S. sciuri E-FD-FOX-GM-TM (FOX-TM) mecA ND 
WWF8B Fajuyi Hall S. sciuri E-FD-FOX-GM-TM (FOX-TM) mecA ND 
WWM1B Moremi Hall S. saprophyticus C-FD-PG-RP-T-TM (T-TM) tetK ND 
WWF5D Fajuyi Hall S. saprophyticus FD-T-TM (T-TM) dfrA, tetK ND 
WWM8I Moremi Hall S. saprophyticus C-FD-T-TM (T-TM) dfrA, tetK ND 
WWPG8I Postgraduate Hall S. cohnii FD-T (T) tetK ND 
WWPG16E Postgraduate Hall S. cohnii FD-T-TM (T-TM) tetK ND 
WWF4F Fajuyi Hall S. epidermidis E-FD-FOX-GM-TM (FOX-TM) dfrA ND 
WWF10G Fajuyi Hall S. haemolyticus FOX-T-TM (FOX-T-TM) dfrG ND 
WWM4G Moremi Hall S. nepalensis C-T (T) tetK ND 
WWF8D Fajuyi Hall S. warneria TM (TM) dfrA, mecA ND 
WWF5B Fajuyi Hall S. equorum C- FD-FOX- T-TM- (FOX-T-TM) dfrA, tetK ND 

Key: C: Chloramphenicol, CIP: Ciprofloxacin, E: Erythromycin, FD: Fusidic acid, FOX: Cefoxitin, GM: Gentamicin, PG: Penicillin G, RP: Rifampicin, T: Tetracycline, TM: Trimethoprim. ND: Not detected. WWM, WWF, and WWPG: grey-water samples from Moremi Hall, Fajuyi Hall and Postgraduate Hall, respectively. OPI, OPP, and OPO: wastewater samples from oxidation in-let, pond and outlet, respectively. Antibiotics in parenthesis were screened for their resistance genes using PCR.

aPhenotypically susceptible to cefoxitin (27 mm) but mecA positive.

DISCUSSION

Wastewater generation and treatment is an integral part of anthropogenic activities which could facilitate the development and spread of ARB. Wastewater usually ends up in other water bodies handled by lower stream end-users and could pose a threat to public health. In this study, a total of eleven staphylococcal species were identified from WWTP and grey-water samples in the University. Some members of the staphylococci recovered in this study (i.e. S. aureus, S. epidermidis, S. saprophyticus, S. haemolyticus, S. sciuri and S. cohnii) have been reported in hospital wastewater effluents and municipal WWTP in Nigeria (Oladipo et al. 2019) and Spain (Gómez et al. 2016), respectively. Furthermore, 53% (32/60) of the isolates in our study were MDR and detected across different sampling sites. This level of MDR is similar to recent reports from hospital wastewater in Ile-Ife (Oladipo et al. 2019) and Ibadan (Adekanmbi et al. 2019) in South-West Nigeria. These findings suggest that wastewater could be a potential reservoir for ARB in Nigeria. The proportion of methicillin-resistant staphylococci was 25% (15/60), and the mecA gene was detected in seven (including one MRSA) of the 20 isolates screened. Moreover, all the S. sciuri isolates investigated were mecA positive. This species has been described with carriage of the SCCmec-like mecA with a putative antibiotic resistance gene pool, with considerable ability to survive in various environments (Schoenfelder et al. 2017). The presence of MRSA in wastewater is a public health concern as it indicates that the non-clinical environment could play a role in its transmission to humans (Porrero et al. 2014). Although data on microbial exposure on WWTP workers are not available in Nigeria, the identification of a PVL-positive MSSA from WWTP in this study is also of concern, particularly for WWTP workers and individuals who could be exposed through inhalation or dermal exposure to reclaimed wastewater (Goldstein et al. 2012).

Trimethoprim and tetracycline are widely used in Nigeria due to their low cost and broad availability (Shittu et al. 2011). However, trimethoprim resistance in staphylococci has been reported to be as high as 85% in humans (Nurjadi et al. 2014; Ayepola et al. 2018). Furthermore, the prevalence of tetracycline-resistant staphylococci has been reported to be about 55% in human samples (Shittu et al. 2011). The molecular basis for trimethoprim resistance is attributed to these resistance (dfrA, dfrB, dfrG and dfrK) genes. Similarly, resistance to tetracycline is conferred by various mechanisms including efflux pump, enzymatic and ribosomal protections, but mainly through the tetK and tetM genes (Schwarz et al. 2014). In this study, resistance to trimethoprim and tetracycline was observed across different staphylococcal species. The multiplex PCR assay also provided some insights into their gene determinants. Resistance to trimethoprim was mediated by the dfrA and dfrG genes. This resistance determinant (dfrG) has been reported as predominant in clinical S. aureus isolates in Nigeria (Nurjadi et al. 2014). We observed that some isolates were resistant to trimethoprim but were dfrA and dfrG gene negative, and should be further investigated. In addition, the tetK gene was detected in most of the tetracycline-resistant isolates analyzed in our investigation. The multiplex PCR assay is a cost-effective method that could assist in the prompt characterization of staphylococcal isolates exhibiting resistance to these classes of antibiotics in Nigeria. The detection of these antibiotic resistance genes in a non-clinical environment warrants further investigation as potential reservoirs for dissemination to clinical settings.

The number of samples and isolates analyzed was a limitation in the study. Nevertheless, this investigation provides baseline information on antibiotic-resistant staphylococci from wastewater and the associated resistance genes from a non-clinical setting. This could be of public health significance as wastewater could be a medium for the dissemination of ARB in the environment. Moreover, innovative wastewater treatment strategies are needed to minimize the potential health risks associated with the spread of ARB. Furthermore, synergy across the human, animal and environmental health sectors is essential with the goal on the establishment of a national antimicrobial resistance (AMR) surveillance system using a ‘One Health’ approach in Nigeria.

CONCLUSIONS

The study has provided baseline information on antibiotic-resistant staphylococci in WWTP and grey-water samples in Ile-Ife, Nigeria. The detection of antibiotic resistance genes in staphylococcal isolates from the non-clinical environment could have a significant public health impact on humans. In addition, antibiotic resistance genes could be transferred to other pathogens through horizontal gene transfer. Further study is required to investigate the clonal nature (genetic relatedness) of the staphylococci. This would help to understand the evolution and epidemiology of the staphylococci in the wastewater environment.

ACKNOWLEDGEMENTS

We acknowledge the assistance of Ms Sandra Adelaide King, Department of Parasitology, Noguchi Memorial Institute of Medical Research (NMIMR), Accra, Ghana, in the development of the multiplex PCR. In addition, funding from the Alexander von Humboldt Foundation (‘Georg Forster-Forschungsstipendium’) and Deutsche Forschungsgemeinschaft (DFG: SCHA 1994/5-1) for AOS is acknowledged.

ETHICAL STATEMENT

Formal approval of the ethics committee was not required as environmental samples were analyzed.

DATA AVAILABILITY STATEMENT

All relevant data are included in the paper or its Supplementary Information.

REFERENCES

REFERENCES
Adekanmbi
A. O.
,
Adeyemi
A. O.
&
Olajide
O. M.
2019
Occurrence of multidrug resistant and extended spectrum β-lactamase (ESBL) – producing Escherichia coli in wastewater of two healthcare facilities in Ibadan, Nigeria
.
World News Nat. Sci.
26
,
167
175
.
Adelowo
O. O.
,
Caucci
S.
,
Banjo
O. A.
,
Nnanna
O. C.
,
Awotipe
E. O.
,
Peters
F. B.
,
Fagade
O. E.
&
Berendonk
T. U.
2018
Extended-Spectrum Beta-Lactamase (ESBL)-producing bacteria isolated from hospital wastewaters, rivers and aquaculture sources in Nigeria
.
Environ. Sci. Pollut. Res.
25
,
2744
2755
.
doi: 10.1007/s11356-017-0686-7
.
Argudín
M. A.
,
Tenhagen
B. A.
,
Fetsch
A.
,
Sachsenröder
J.
,
Käsbohrer
A.
,
Schroeter
A.
,
Hammerl
J. A.
,
Hertwig
S.
,
Helmuth
R.
,
Braunig
J.
,
Mendoza
M. C.
,
Appel
B.
,
Rodicio
M. R.
&
Guerra
B.
2011
Virulence and resistance determinants of German Staphylococcus aureus ST398 isolates from nonhuman sources
.
Appl. Environ. Microbiol.
77
,
3052
3060
.
doi:10.1128/AEM.02260-10
.
Borjesson
S.
,
Matussek
A.
,
Melin
S.
,
Lofgren
S.
&
Lindgren
P. E.
2010
Methicillin-resistant Staphylococcus aureus (MRSA) in municipal wastewater: an uncharted threat?
J. Appl. Microbiol.
108
,
1244
1251
.
doi: 10.1111/j.1365-2672.2009.04515.x
.
CLSI. Clinical Laboratory Standards Institute
.
2016
Performance Standards for Antimicrobial Susceptibility Testing
.
Twenty-Fourth Informational Supplement M100-S24
,
Wayne, Pennsylvania
.
Faria
C.
,
Vaz-Moreira
I.
,
Serapicos
E.
,
Nunes
O.
&
Manaia
C. M.
2009
Antibiotic resistance in coagulase-negative staphylococci isolated from wastewater and drinking water
.
Sci. Total Environ.
407
,
3876
3882
.
doi: 10.1016/j.scitotenv.2009.02.034
.
Goldstein
R. E. R.
,
Micallef
S. A.
,
Gibbs
S. G.
,
Davis
J. A.
,
He
X.
,
George
A.
,
Kleinfelter
L. M.
,
Schreiber
N. A.
,
Mukherjee
S.
,
Joesph
S. W.
&
Sapkota
A. R.
2012
Methicillin-Resistant Staphylococcus aureus (MRSA) detected at four U.S. wastewater treatment plants
.
Environ. Health Perspect.
120
,
1551
1558
.
doi: 10.1289/ehp.1205436
.
Gómez
P.
,
Lozano
C.
,
Benito
D.
,
Estepa
V.
,
Tenorio
C.
,
Zarazaga
M.
&
Torres
C.
2016
Characterization of staphylococci in urban wastewater treatment plants in Spain, with detection of methicillin-resistant Staphylococcus aureus ST398
.
Environ. Pollut.
212
,
71
76
.
doi: 10.1016/j.envpol.2016.01.038
.
Han
H. W.
,
Chang
H. C.
,
Hunag
A. H.
&
Chang
T. C.
2015
Optimization of the score cutoff value for routine identification of Staphylococcus species by matrix-assisted laser desorption ionization– time-of-flight mass spectrometry
.
Diagn. Microbiol. Infect. Dis.
83
,
349
354
.
doi: 10.1016/j.diagmicrobio.2015.08.003
.
Lateef
A.
,
Ufuoma
P. E.
&
Yekeen
T. A.
2007
Bacteriology and genotoxicity of some pharmaceutical wastewaters in Nigeria
.
Int. J. Environ. Health
1
,
551
562
.
doi: 10.1504/ijenvh.2007.018572
.
Manaia
C. M.
,
Rocha
J.
,
Scaccia
N.
,
Marano
R.
,
Radu
E.
,
Biancullo
F.
,
Cerqueira
F.
,
Fortunato
G.
,
Iakovides
I. C.
,
Zammit
I.
,
Kampouris
I.
,
Vaz-Moreira
I.
&
Nunes
O. C.
2018
Antibiotic resistance in wastewater treatment plants: tackling the black box
.
Environ. Int.
115
,
312
324
.
doi: 10.1016/j.envint.2018.03.044
.
Naidoo
S.
&
Olaniran
A. O.
2014
Treated wastewater effluent as a source of microbial pollution of surface water resources
.
Int. J. Environ. Res. Public Health
11
,
249
270
.
doi: 10.3390/ijerph110100249
.
Ng
L. K.
,
Martin
I.
,
Alfa
M.
&
Mulvey
K.
2001
Multiplex PCR for the detection of tetracycline resistant genes
.
Mol. Cell. Probes
15
,
209
215
.
doi: 10.1006/mcpr.2001.0363
.
Nurjadi
D.
,
Olalekan
A. O.
,
Layer
F.
,
Shittu
A. O.
,
Alabi
A.
,
Ghebremedhin
B.
,
Schaumburg
F.
,
Hofmann-Eifler
J.
,
Van Genderen
P. J.
,
Caumes
E.
,
Fleck
R.
,
Mockenhaupt
F. P.
,
Herrmann
M.
,
Kern
W. V.
,
Abdulla
S.
,
Grobusch
M. P.
,
Kremsner
P. G.
,
Wolz
C.
&
Zanger
P.
2014
Emergence of trimethoprim resistance gene dfrG in Staphylococcus aureus causing human infection and colonization in sub-Saharan Africa and its import to Europe
.
J. Antimicrob. Chemother.
69
,
2361
2368
.
doi: 10.1093/jac/dku174
.
Oyetibo
G. O.
,
Ilori
M. O.
,
Adebusoye
S. A.
,
Obayori
O. F.
&
Amund
O. O.
2010
Bacteria with dual resistance to elevated concentrations of heavy metals and antibiotics in Nigerian contaminated systems
.
Environ. Monit. Assess.
168
,
305
314
.
doi: 10.1007/s10661-009-1114-3
.
Porrero
M. C.
,
Harrison
E. M.
,
Fernández-Garayzábal
J. F.
,
Paterson
G. K.
,
Díez-Guerrier
A.
,
Holmes
M. A.
&
Domínguez
L.
2014
Detection of mecC-Methicillin-resistant Staphylococcus aureus isolates in river water: a potential role for water in the environmental dissemination
.
Environ. Microbiol. Rep.
6
,
705
708
.
doi: 10.1111/1758-2229.12191
.
Schoenfelder
S. M.
,
Dong
Y.
,
Feßler
A. T.
,
Schwarz
S.
,
Schoen
C.
,
Köck
R.
&
Ziebuhr
W.
2017
Antibiotic resistance profiles of coagulase-negative staphylococci in livestock environments
.
Vet. Microbiol.
200
,
79
87
.
doi: 10.1016/j.vetmic.2016.04.019
.
Schwarz
S.
,
Shen
J.
,
Wendlandt
S.
,
Feβler
A. T.
,
Wang
Y.
,
Kadlec
K.
&
Wu
C.
2014
Plasmid-mediated antimicrobial resistance in staphylococci and other Firmicutes
.
Microbiol. Spectr.
2
(
6
).
doi:10.1128/microbiolspec.PLAS-0020-2014
.
Shittu
A. O.
,
Okon
K.
,
Adesida
S.
,
Oyedara
O.
,
Witte
W.
,
Strommenger
B.
,
Layer
F.
&
Nübel
U.
2011
Antibiotic resistance and molecular epidemiology of Staphylococcus aureus in Nigeria
.
BMC Microbiol.
11
,
92
.
doi:10.1186/1471-2180-11-92
.

Author notes

Current address: Institute of Medical Microbiology, University Hospital Münster, Domagkstrasse 10, 48149 Münster, Germany

Supplementary data