Skip to Main Content

PCR analysis was carried out in 50 μL amplification reaction mixtures containing 1 × PCR buffer (Invitrogen), 5% dimethyl sulfoxide (w/v), 200 μmolL−1 dNTPs (Invitrogen), 2 U of Platinum Taq DNA Polymerase (Invitrogen), 1 pmol of each primer, optimum MgCl2 concentration (Table 1) and about 20 ng of DNA template. The cycling conditions consisted of an initial 95 °C step for 5 min and 40 cycles of amplification at 95 °C for 1 min, an annealing temperature specific for each primer set (Table 1) for 1 min, 72 °C for 1 min and a final elongation at 72 °C for 6 min. PCR products were loaded onto a 1% (v/v) agarose gel, and were separated by electrophoresis at 70 V for 2 h in 1 × TAE (40 mmol L−l Tris base, 20 mmol L−1 sodium acetate, 1 mmol L−l EDTA, pH 8.0) buffer with a 100 bp DNA ladder (Invitrogen) as molecular weight standard. The gels were stained with ethidium bromide and gel images were digitalized with the Video Documentation System and analyzed with Image-Master software (Amersham Pharmacia Biotech).

Table 1

Oligonucleotides, target genes, and PCR conditions

PrimerSequence (5′-3′)TargetMgCl2 (mM)Annealing temp (°C)Product size (bp)Reference
HuM113F ACTCTTGGCCAGCCTTCTGA 16S rRNA/Human-associated Bacteroidales 1.5 57 290 This study 
HuM403R ACCCATAGGGCAGTCATCCT      
Mnif-342F AACAGAAAACCCAGTGAAGAG nifH/Methanobrevibacter smithii 2.0 58 222 Ufnar et al. (2006)  
Mnif-363R ACGTAAAGGCACTGAAAAACC      
CF128F CCAACYTTCCCGWTACTC 16S rRNA/Bovine-associated Bacteroidales 1.5 56 464 Bernhard & Field (2000)  
CF592R AYMTCCCGTCTACGCTCC     Liu et al. (2012)  
Mrnif-F AATATTGCAGCAGCTTACAGTGAA nifH/Methanobrevibacter ruminantium 2.0 56 336 Ufnar et al. (2007a)  
Mrnif-R TGAAAATCCTCCGCAGACC      
PF163F GCGGATTAATACCGTATGA 16S rRNA/Swine-associated Bacteroidales 1.5 55 385 Dick et al. (2005)  
PF548R CCCAATAAATCCGGATAACG     This study 
P23-2 F TCTGCGACACCGGTAGCCATTGA mcrA/P23-2 Clone 2.0 60 258 Ufnar et al. (2007b)  
P23-2 R ATACACTGGCGACATTCTTGAGGATTAC      
HoR201F TGGGGATGCGTCTGATTAGC 16S rRNA/Equine-associated Bacteroidales 1.5 53 242 This study 
HoR442R CCCACACGTGGGTCACTTTA      
GoT285F GCACAAACTGGTTTAAGCGGA mcrA/Methanobrevibacter gottschalkii 1.5 54 120 This study 
GoT404R GGAGAATACGTTAGCAGCACCA      
PrimerSequence (5′-3′)TargetMgCl2 (mM)Annealing temp (°C)Product size (bp)Reference
HuM113F ACTCTTGGCCAGCCTTCTGA 16S rRNA/Human-associated Bacteroidales 1.5 57 290 This study 
HuM403R ACCCATAGGGCAGTCATCCT      
Mnif-342F AACAGAAAACCCAGTGAAGAG nifH/Methanobrevibacter smithii 2.0 58 222 Ufnar et al. (2006)  
Mnif-363R ACGTAAAGGCACTGAAAAACC      
CF128F CCAACYTTCCCGWTACTC 16S rRNA/Bovine-associated Bacteroidales 1.5 56 464 Bernhard & Field (2000)  
CF592R AYMTCCCGTCTACGCTCC     Liu et al. (2012)  
Mrnif-F AATATTGCAGCAGCTTACAGTGAA nifH/Methanobrevibacter ruminantium 2.0 56 336 Ufnar et al. (2007a)  
Mrnif-R TGAAAATCCTCCGCAGACC      
PF163F GCGGATTAATACCGTATGA 16S rRNA/Swine-associated Bacteroidales 1.5 55 385 Dick et al. (2005)  
PF548R CCCAATAAATCCGGATAACG     This study 
P23-2 F TCTGCGACACCGGTAGCCATTGA mcrA/P23-2 Clone 2.0 60 258 Ufnar et al. (2007b)  
P23-2 R ATACACTGGCGACATTCTTGAGGATTAC      
HoR201F TGGGGATGCGTCTGATTAGC 16S rRNA/Equine-associated Bacteroidales 1.5 53 242 This study 
HoR442R CCCACACGTGGGTCACTTTA      
GoT285F GCACAAACTGGTTTAAGCGGA mcrA/Methanobrevibacter gottschalkii 1.5 54 120 This study 
GoT404R GGAGAATACGTTAGCAGCACCA      

Close Modal

or Create an Account

Close Modal
Close Modal