Skip to Main Content

A total of six sets of primers were designed using Allele ID v7.6 software (PREMIER Biosoft, USA) based on available data from GenBank® (www.ncbi.nlm.nih.gov/genbank). We also used Primer-BLAST (http://www.ncbi.nlm.nih.gov/tools/primer-blast/) to confirm lack of DNA homology in bacterial species other than the mentioned pathogens. The sequences and amplicon sizes of the primers are shown in Tables 1 and 2.

Table 1

List of gene-specific PCR primers for the first protocol

Target microorganismTarget genePrimer sets (5′ to 3′)Annealing temperature (°C)Amplicon size (bp)Primer concentration (pmol)
E. coli uidA GAACTGGCAGACTATC 60 1,103 
CGTATTCGGTGATGAT 
Shigella sonnei int GCTGGATGAACGATGTCCAC 60 356 
ATCTGGCGGCTATGAGATGG 
Pseudomonas aeruginosa gyrB CAAGGGCAAGATCCTCAAC 60 217 
CATCTGGCGGAAGAAGAAG 
Target microorganismTarget genePrimer sets (5′ to 3′)Annealing temperature (°C)Amplicon size (bp)Primer concentration (pmol)
E. coli uidA GAACTGGCAGACTATC 60 1,103 
CGTATTCGGTGATGAT 
Shigella sonnei int GCTGGATGAACGATGTCCAC 60 356 
ATCTGGCGGCTATGAGATGG 
Pseudomonas aeruginosa gyrB CAAGGGCAAGATCCTCAAC 60 217 
CATCTGGCGGAAGAAGAAG 
Table 2

List of gene-specific PCR primers for the second protocol

Target microorganismTarget genePrimer sets (5′ to 3′)Annealing temperature (°C)Amplicon size (bp)Primer concentration (pmol)
Vibrio cholerae ompW TTAACGCTTGGCTATATGTT 60 345 
GAGGAACCAGCTATCATTG 
Salmonella typhimurium invA GGCGATAGCGATAATATG 60 500 
AAATAGACCGTAAATTGTTCA 
Coliforms lacZ TGAAGCAGAACAACTTTA 60 600 
CATATTTAATCAGCGACTG 
Target microorganismTarget genePrimer sets (5′ to 3′)Annealing temperature (°C)Amplicon size (bp)Primer concentration (pmol)
Vibrio cholerae ompW TTAACGCTTGGCTATATGTT 60 345 
GAGGAACCAGCTATCATTG 
Salmonella typhimurium invA GGCGATAGCGATAATATG 60 500 
AAATAGACCGTAAATTGTTCA 
Coliforms lacZ TGAAGCAGAACAACTTTA 60 600 
CATATTTAATCAGCGACTG 

Close Modal

or Create an Account

Close Modal
Close Modal