Skip to Main Content
Table 1

16S rRNA primers and PCR conditions for the first and second round PCRs used to develop the NGS library using eDNA extracted using the three most promising methods

Primers (5′–3′)PCR cyclesAnnealing temperature
First PCR UniA-V5F; acctgcctgccg-ATTAGATACCCNGGTAG 25 55 °C 
 UniB-V6R; acgccaccgagc-CGACAGCCATGCANCACCT   
Second PCR UniA; CATCTCATCCCTGCGTGTCTCCGACTCAGXXXXXXXXXXGATacctgcctgccg 60 °C 
 UniB; CCTCTCTATGGGCAGTCGGTGATacgccaccgagc   
Primers (5′–3′)PCR cyclesAnnealing temperature
First PCR UniA-V5F; acctgcctgccg-ATTAGATACCCNGGTAG 25 55 °C 
 UniB-V6R; acgccaccgagc-CGACAGCCATGCANCACCT   
Second PCR UniA; CATCTCATCCCTGCGTGTCTCCGACTCAGXXXXXXXXXXGATacctgcctgccg 60 °C 
 UniB; CCTCTCTATGGGCAGTCGGTGATacgccaccgagc   

The UniA primer in the second PCR (ligation of barcode and adaptor sequences for NGS) includes individually unique 10–12 bp (indicated by XXXXXXXXXX) ‘barcode’ sequences that allow sorting of final sequence reads to the original sample after multiplexed sequencing (He et al. 2017).

Close Modal

or Create an Account

Close Modal
Close Modal