Skip to Main Content
Table 1

Primer details for the detection of erythromycin- and quinolones-resistant genes in E. coli

Antimicrobial agentResistant geneSequenceSize (bp)Annealing temperature (°C)References
Erythromycin ere(A) (F) GCCGGTGCTCATGAACTTGAG 419 52 Momtaz et al. (2012)  
(R) CGACTCTATTCGATCAGAGGC 
Quinolones qnrA (F) GGGTATGGATATTATTGATAAAG 670 50 Momtaz et al. (2012)  
(R) CTAATCCGGCAGCACTATTTA 
Antimicrobial agentResistant geneSequenceSize (bp)Annealing temperature (°C)References
Erythromycin ere(A) (F) GCCGGTGCTCATGAACTTGAG 419 52 Momtaz et al. (2012)  
(R) CGACTCTATTCGATCAGAGGC 
Quinolones qnrA (F) GGGTATGGATATTATTGATAAAG 670 50 Momtaz et al. (2012)  
(R) CTAATCCGGCAGCACTATTTA 
Close Modal

or Create an Account

Close Modal
Close Modal