Skip to Main Content
Table 1

Sequences of specific primers for virulence genes detection (act, aerA, hlyA, asp and amp)

PrimersSequence (5′–3′)Target geneAnnealing (°C)Fragment size (bp)Reference
act-F AGAAGGTGACCACCAAGAACA act 55 232 Khor et al. (2015)  
act-R AACTGACATCGGCCTTGAACTC 
aer-F CCTATGGCCTGAGCGAGAAG aer55 431 Körkoca et al. (2014)  
aer-R CCAGTTCCAGTCCCACCACT 
hlyA-F GGCCGGTGGCCCGAAGATACGGG hly62 597 Igbinosa & Okoh (2013)  
hlyA-R GGCGGCGCCGGACGAGACGGG 
AP-165 CCCTCCAACAGCAACTTCTGGAACCTGGTG asp 58 322 Takahashi et al. (2014)  
AP-166 TCCGGGTAGGCGGACATCAGCAGCGCCATG 
ASMP-03 AGGACGCCACCGGCCCGGGGGGCAA amp 60 550 Takahashi et al. (2014)  
ASMP-04 GACCAGCCAGTCGTTGCTCCCCTT 
PrimersSequence (5′–3′)Target geneAnnealing (°C)Fragment size (bp)Reference
act-F AGAAGGTGACCACCAAGAACA act 55 232 Khor et al. (2015)  
act-R AACTGACATCGGCCTTGAACTC 
aer-F CCTATGGCCTGAGCGAGAAG aer55 431 Körkoca et al. (2014)  
aer-R CCAGTTCCAGTCCCACCACT 
hlyA-F GGCCGGTGGCCCGAAGATACGGG hly62 597 Igbinosa & Okoh (2013)  
hlyA-R GGCGGCGCCGGACGAGACGGG 
AP-165 CCCTCCAACAGCAACTTCTGGAACCTGGTG asp 58 322 Takahashi et al. (2014)  
AP-166 TCCGGGTAGGCGGACATCAGCAGCGCCATG 
ASMP-03 AGGACGCCACCGGCCCGGGGGGCAA amp 60 550 Takahashi et al. (2014)  
ASMP-04 GACCAGCCAGTCGTTGCTCCCCTT 
Close Modal

or Create an Account

Close Modal
Close Modal