Skip to Main Content
Table 1

Primer and TaqMan™ probe sequences for qPCR assays

Target genePrimer sequence (5′-3′)TaqMan probe (5′-3′)Amplicon length (bp)Source
p35 F: GCCTCTGCCGACAGTGGT
R: AAGACGTGGTTGGAACGTC TTC 
FAM-CAAAGATGGACCCCCAC CCACG-TAMRA 82 Waiblinger et al. (2008)  
nos F: GTCTTGCGATGATTATCAT ATAATTTCTG
R: CGCTATATTTTGTTTTCTATC GCGT 
FAM- AGATGGGTTTTTATGAT
TAGAGTCCCGCAA-TAMRA 
120 Mano et al. (2008)  
bla F: TGCGCGGAACCCCTATTTGT
R: GCGGCGACCGAG TTGCTCTT 
Not applicable 382 Badosa et al. (2004)  
nptII F: AGGAAGCGGTCAGCCCAT
R: GCGTTGGCTACCCGTGATAT 
FAM-CGCCGCCAAGCTCTTCA GCAA-TAMRA 60 Mason et al. (2002)  
16S F: TCCTACGGGAGGCAGCAG
R: GGACTACCAGGGTATCTAA TCCTGTT 
FAM- CGTATTACCGCGGCTGC TGGCAC-TAMRA 466 Nadkarni et al. (2002)  
CaMV ORF VII F: AGCGGTCAAAATATTGCTTA
R:AACTTACCGTATGCTAGATTACCT 
Not applicable 141 Love et al. (2005)  
Target genePrimer sequence (5′-3′)TaqMan probe (5′-3′)Amplicon length (bp)Source
p35 F: GCCTCTGCCGACAGTGGT
R: AAGACGTGGTTGGAACGTC TTC 
FAM-CAAAGATGGACCCCCAC CCACG-TAMRA 82 Waiblinger et al. (2008)  
nos F: GTCTTGCGATGATTATCAT ATAATTTCTG
R: CGCTATATTTTGTTTTCTATC GCGT 
FAM- AGATGGGTTTTTATGAT
TAGAGTCCCGCAA-TAMRA 
120 Mano et al. (2008)  
bla F: TGCGCGGAACCCCTATTTGT
R: GCGGCGACCGAG TTGCTCTT 
Not applicable 382 Badosa et al. (2004)  
nptII F: AGGAAGCGGTCAGCCCAT
R: GCGTTGGCTACCCGTGATAT 
FAM-CGCCGCCAAGCTCTTCA GCAA-TAMRA 60 Mason et al. (2002)  
16S F: TCCTACGGGAGGCAGCAG
R: GGACTACCAGGGTATCTAA TCCTGTT 
FAM- CGTATTACCGCGGCTGC TGGCAC-TAMRA 466 Nadkarni et al. (2002)  
CaMV ORF VII F: AGCGGTCAAAATATTGCTTA
R:AACTTACCGTATGCTAGATTACCT 
Not applicable 141 Love et al. (2005)  
Close Modal

or Create an Account

Close Modal
Close Modal