Skip to Main Content
Table 1

Primers, probes and IAC sequences used in qPCR assays

Target organismPrimer/probeOligo sequence (5′ → 3′)References
Campylobacter spp. hipO-F
hipO-Pa,g
hipO-R
IAC-Pb,e
IAC-Target 
AATGCACAAATTTGCCTTATAAAAGC
ACATACTACTTCTTTATTGCTTGC
TICCATTAAAATTCTGACTTGCTAAATA
TTCGAAATGTCCGTTCGGTGGC
AATGCACAAATTTGCCTTATAAAAGCGTAT
TCGAAATGTCCGTTCGGTTGGCGCTATGAA
CAAGTCAGAATTTTAATCCIA 
Toplak et al. (2012)  
Salmonella spp. fimA-F
fimA-Pa,e
fimA-R
IAC-Pb,e
IAC-Target 
CACTAAATCCGCCGATCAAAC
CTGGGTCAATACCGTACCGCCAGC
AGTCGTATTACCAATCGCCGTAA
TTCGAAATGTCCGTTCGGTTGGC
CACTAAATCCGCCGATCAAACGTATTCGAA
ATGTCCGTTCGGTTGGCGCTATGAAGAGAT
ACGCGGTGGAACCTGGAATTACGGCGATTG
GTAATACGACT 
This study 
Shiga toxin-producing E. coli (STEC) — stx1 and stx2 toxin stx1-F
stx1-Pa,e
stx1-R
stx2-F
stx2-Pc,e
stx2-R
IAC-Pd,f
IAC-Target 
GGATAATTTGTTTGCAGTTGATGTC
CCGTAGATTATTAAACCGCCCTTCCTCTGGA
CAAATCCTGTCACATATAAATTATTTCGT
GGGCAGTTATTTTGCTGTGGA
ATGTCTATCAGGCGCGTTTTGACCATCTT
GAAAGTATTTGTTGCCGTATTAACGA
TTCGAAATGTCCGTTCGGTTGGC
GGGCAGTTATTTTGCTGTGGAGTATTCGAA
ATGTCCGTTCGGTTGGCGCTATGAAGAGAT
ACGCGGTGGAACCTGGAGTCGTTAATACGG
CAACAAATACTTTC 
This study 
Target organismPrimer/probeOligo sequence (5′ → 3′)References
Campylobacter spp. hipO-F
hipO-Pa,g
hipO-R
IAC-Pb,e
IAC-Target 
AATGCACAAATTTGCCTTATAAAAGC
ACATACTACTTCTTTATTGCTTGC
TICCATTAAAATTCTGACTTGCTAAATA
TTCGAAATGTCCGTTCGGTGGC
AATGCACAAATTTGCCTTATAAAAGCGTAT
TCGAAATGTCCGTTCGGTTGGCGCTATGAA
CAAGTCAGAATTTTAATCCIA 
Toplak et al. (2012)  
Salmonella spp. fimA-F
fimA-Pa,e
fimA-R
IAC-Pb,e
IAC-Target 
CACTAAATCCGCCGATCAAAC
CTGGGTCAATACCGTACCGCCAGC
AGTCGTATTACCAATCGCCGTAA
TTCGAAATGTCCGTTCGGTTGGC
CACTAAATCCGCCGATCAAACGTATTCGAA
ATGTCCGTTCGGTTGGCGCTATGAAGAGAT
ACGCGGTGGAACCTGGAATTACGGCGATTG
GTAATACGACT 
This study 
Shiga toxin-producing E. coli (STEC) — stx1 and stx2 toxin stx1-F
stx1-Pa,e
stx1-R
stx2-F
stx2-Pc,e
stx2-R
IAC-Pd,f
IAC-Target 
GGATAATTTGTTTGCAGTTGATGTC
CCGTAGATTATTAAACCGCCCTTCCTCTGGA
CAAATCCTGTCACATATAAATTATTTCGT
GGGCAGTTATTTTGCTGTGGA
ATGTCTATCAGGCGCGTTTTGACCATCTT
GAAAGTATTTGTTGCCGTATTAACGA
TTCGAAATGTCCGTTCGGTTGGC
GGGCAGTTATTTTGCTGTGGAGTATTCGAA
ATGTCCGTTCGGTTGGCGCTATGAAGAGAT
ACGCGGTGGAACCTGGAGTCGTTAATACGG
CAACAAATACTTTC 
This study 

F, forward primer; R, reverse primer; P, TaqMan® probe.

a6-FAM reporter.

bCAL Fluor Orange 560.

cCAL Fluor Gold 540.

dCAL Fluor Red 590.

eBHQ1 quencher.

fBHQ2 quencher.

gBHQplus quencher.

Close Modal

or Create an Account

Close Modal
Close Modal