Skip to Main Content
Table 1

Primers used for the study

GenesDescriptionPrimersAmplicon sizesReferences
mecA Methicillin resistance Forward: TCCAGATTACAACTTCACCAGG
Reverse: CCACTTCATATCTTGTAACG 
162 bp Larsen et al. (2008)  
PVL Panton-Valentine Leukocidin Forward: GCTGGACAAAACTTCTTGGAATAT
Reverse: GATAGGACACCAATAAATTCTGGATTG 
80 bp Larsen et al. (2008)  
dfrA Trimethoprim resistance Forward: CACTTGTAATGGCACGGAAA
Reverse: CGAATGTGTATGGTGGAAAG 
270 bp Argudín et al. (2011)  
dfrG Trimethoprim resistance Forward: TGCTGCGATGGATAAGAA
Reverse: TGGGCAAATACCTCATTCC 
405 bp Argudín et al. (2011)  
tetK Tetracycline resistance Forward: TCGATAGGAACAGCAGTA
Reverse: CAGCAGATCCTACTCCTT 
169 bp Ng et al. (2001)  
Spa Staphylococcal protein A Forward : TAAAGACGATCCTTCGGTGAGC
Reverse: CAGCAGTAGTGCCGTTTGCTT 
Variable Larsen et al. (2008)  
GenesDescriptionPrimersAmplicon sizesReferences
mecA Methicillin resistance Forward: TCCAGATTACAACTTCACCAGG
Reverse: CCACTTCATATCTTGTAACG 
162 bp Larsen et al. (2008)  
PVL Panton-Valentine Leukocidin Forward: GCTGGACAAAACTTCTTGGAATAT
Reverse: GATAGGACACCAATAAATTCTGGATTG 
80 bp Larsen et al. (2008)  
dfrA Trimethoprim resistance Forward: CACTTGTAATGGCACGGAAA
Reverse: CGAATGTGTATGGTGGAAAG 
270 bp Argudín et al. (2011)  
dfrG Trimethoprim resistance Forward: TGCTGCGATGGATAAGAA
Reverse: TGGGCAAATACCTCATTCC 
405 bp Argudín et al. (2011)  
tetK Tetracycline resistance Forward: TCGATAGGAACAGCAGTA
Reverse: CAGCAGATCCTACTCCTT 
169 bp Ng et al. (2001)  
Spa Staphylococcal protein A Forward : TAAAGACGATCCTTCGGTGAGC
Reverse: CAGCAGTAGTGCCGTTTGCTT 
Variable Larsen et al. (2008)  
Close Modal

or Create an Account

Close Modal
Close Modal