Skip to Main Content
Table 1

List of primers used for PCR amplification

Specific gene for amplificationPrimerPrimer sequence (5′–3′)Amplicon size (bp)PCR conditionsReferences
vanForward
Reverse 
ATGAATAGAATAAAAGTTGC
TCACCCCTTTAACGCTAATA 
1,032 bp 98 °C/2 min – ID
98 °C/10 s – D
50 °C/1 min – A
72 °C/1 min – PE
72 °C/5 min – FE
Cycles – 35 
Saha et al. (2008)  
vanForward
Reverse 
GTGACAAACCGGAGGCGAGGA
CCGCCATCCTCCTGCAAAAAA 
433 bp 95 °C/10 min
94 °C/30 s
58 °C/30 s
72 °C/30 s
72 °C/10 min
Cycles – 30 
Clark et al. (1993)  
vanForward
Reverse 
GAAAGACAACAGGAAGACCGC
ATCGCATCACAAGCACCAATC 
796 bp 95 °C/10 min
94 °C/30 s
58 °C/30 s
72 °C/30 s
72 °C/10 min
Cycles – 30 
Clark et al. (1993)  
vanHAX Forward
Reverse 
ATGAATAACATCGGCATTAC
TTATTTAACGGGGAAATC 
2.6 kb 98 °C/2 min
98 °C/10 s
50 °C/1 min
72 °C/1 min 30 s
72 °C/5 min
Cycles – 35 
Saha et al. (2008)  
vanForward
Reverse 
ATGAATAACATCGGCATTAC
CTATTCATGCTCCTGTCTCC 
969 bp 98 °C/2 min
98 °C/10 s
50 °C/1 min
72 °C/1 min
72 °C/5 min
Cycles – 35 
Saha et al. (2008)  
vanForward
Reverse 
ATGGAAATAGGATTTACTTT
TTATTTAACGGGGAAATC 
609 bp 98 °C/2 min
98 °C/10 s
50 °C/1 min
72 °C/30 s
72 °C/5 min
Cycles – 35 
Saha et al. (2008)  
Specific gene for amplificationPrimerPrimer sequence (5′–3′)Amplicon size (bp)PCR conditionsReferences
vanForward
Reverse 
ATGAATAGAATAAAAGTTGC
TCACCCCTTTAACGCTAATA 
1,032 bp 98 °C/2 min – ID
98 °C/10 s – D
50 °C/1 min – A
72 °C/1 min – PE
72 °C/5 min – FE
Cycles – 35 
Saha et al. (2008)  
vanForward
Reverse 
GTGACAAACCGGAGGCGAGGA
CCGCCATCCTCCTGCAAAAAA 
433 bp 95 °C/10 min
94 °C/30 s
58 °C/30 s
72 °C/30 s
72 °C/10 min
Cycles – 30 
Clark et al. (1993)  
vanForward
Reverse 
GAAAGACAACAGGAAGACCGC
ATCGCATCACAAGCACCAATC 
796 bp 95 °C/10 min
94 °C/30 s
58 °C/30 s
72 °C/30 s
72 °C/10 min
Cycles – 30 
Clark et al. (1993)  
vanHAX Forward
Reverse 
ATGAATAACATCGGCATTAC
TTATTTAACGGGGAAATC 
2.6 kb 98 °C/2 min
98 °C/10 s
50 °C/1 min
72 °C/1 min 30 s
72 °C/5 min
Cycles – 35 
Saha et al. (2008)  
vanForward
Reverse 
ATGAATAACATCGGCATTAC
CTATTCATGCTCCTGTCTCC 
969 bp 98 °C/2 min
98 °C/10 s
50 °C/1 min
72 °C/1 min
72 °C/5 min
Cycles – 35 
Saha et al. (2008)  
vanForward
Reverse 
ATGGAAATAGGATTTACTTT
TTATTTAACGGGGAAATC 
609 bp 98 °C/2 min
98 °C/10 s
50 °C/1 min
72 °C/30 s
72 °C/5 min
Cycles – 35 
Saha et al. (2008)  

ID, initial denaturation; D, denaturation; A, annealing; PE, primer extension; FE, final.

Close Modal

or Create an Account

Close Modal
Close Modal