Skip to Main Content
Table 1

Primer sequences of the relative resistance genes and reaction conditions

GenesPrimer sequences(5′–3′)Annealing temperature (°C)Length of fragment (bp)
tetF:GCTACATCCTGCTTGCCTTC 55 210 
R:CATAGATCGCCGTGAAGAGG 
tetF:TACGTGAATTTATTGCTTCGG 61 206 
R:ATACAGCATCCAAAGCGCAC 
tetF:GCACGCTGGTTTGGCTACA 56 176 
R:TGGCTGTGATTAGTCTCCTTGA 
tetF:ACAGAAAGCTTATTATATAAC 45 171 
R:TGGCGTGTCTATGATGTTCAC 
sulF:CGCACCGGAAACATCGCTGCAC 56 163 
R:TGAAGTTCCGCCGCAAGGCTCG 
sulF:TCCGGTGGAGGCCGGTATCTGG 56 191 
R:CGGGAATGCCATCTGCCTTGAG 
sulF:CCCATACCCGGATCAAGAATAA 57 143 
R:CAGCGAATTGGTGCAGCTACTA 
blaTEM F:AAGCTTATTAGCGTGT 55 531 
R:TGTCTATGATCTTGT 
blaCTX-M F:GCTGGTTTCAGAA 55 869 
R:TGTGATTAGCTGT 
blaSHV F:TGAATACGTTTTCAC 55 295 
R:TACCTTGTTATTCAC 
intF:GGCTTCGTGATGCCTGCTT 57 146 
R:CATTCCTGGCCGTGGTTCT 
16S rDNA 27F:AGAGTTTGATCCTGCCTCAG 56 1465 
1492R:TACGGYTACCTTGTTACGACTT 
GenesPrimer sequences(5′–3′)Annealing temperature (°C)Length of fragment (bp)
tetF:GCTACATCCTGCTTGCCTTC 55 210 
R:CATAGATCGCCGTGAAGAGG 
tetF:TACGTGAATTTATTGCTTCGG 61 206 
R:ATACAGCATCCAAAGCGCAC 
tetF:GCACGCTGGTTTGGCTACA 56 176 
R:TGGCTGTGATTAGTCTCCTTGA 
tetF:ACAGAAAGCTTATTATATAAC 45 171 
R:TGGCGTGTCTATGATGTTCAC 
sulF:CGCACCGGAAACATCGCTGCAC 56 163 
R:TGAAGTTCCGCCGCAAGGCTCG 
sulF:TCCGGTGGAGGCCGGTATCTGG 56 191 
R:CGGGAATGCCATCTGCCTTGAG 
sulF:CCCATACCCGGATCAAGAATAA 57 143 
R:CAGCGAATTGGTGCAGCTACTA 
blaTEM F:AAGCTTATTAGCGTGT 55 531 
R:TGTCTATGATCTTGT 
blaCTX-M F:GCTGGTTTCAGAA 55 869 
R:TGTGATTAGCTGT 
blaSHV F:TGAATACGTTTTCAC 55 295 
R:TACCTTGTTATTCAC 
intF:GGCTTCGTGATGCCTGCTT 57 146 
R:CATTCCTGGCCGTGGTTCT 
16S rDNA 27F:AGAGTTTGATCCTGCCTCAG 56 1465 
1492R:TACGGYTACCTTGTTACGACTT 
Close Modal

or Create an Account

Close Modal
Close Modal