Skip to Main Content

A volume of 140 μL of concentrated sample was subjected to viral RNA/DNA extraction (Qiagen, Germany) followed by reverse transcription (SuperScript III Reverse transcriptase, Invitrogen, USA) for RNA viruses. Quantitative RT-PCR was performed using SYBER green master mix (Luna, New England) and in-house designed primers (Table 1). Reaction mixture was subjected to the following temperature conditions, initial denaturation: 95 °C for 60 s, denaturation at 95 °C for 15 s, annealing: 55 °C for adenovirus and 57 °C for both HAV and rotavirus for 10 s, extension at 60 °C for 15 s for 40 cycles (Buston et al. 2009).

Table 1

Sets of in-house primers used for viral detection

VirusPrimer sequenceAnnealing temperature
Adenovirus F: CCCACGGTGGCGCCTAC  
R: AACCGCAGCGTCAAACGCT 55 
HAV F:TGATTAGCATGGAGCTGTAGG  
R: CAAAGCATCTCTTCATAGAAGTA 57 
Rotavirus F: TCAGTCTATTTTAAAGAGTACTCA  
R: TTTGATTCTCCCGATTGTTGATA 57 
VirusPrimer sequenceAnnealing temperature
Adenovirus F: CCCACGGTGGCGCCTAC  
R: AACCGCAGCGTCAAACGCT 55 
HAV F:TGATTAGCATGGAGCTGTAGG  
R: CAAAGCATCTCTTCATAGAAGTA 57 
Rotavirus F: TCAGTCTATTTTAAAGAGTACTCA  
R: TTTGATTCTCCCGATTGTTGATA 57 

Close Modal

or Create an Account

Close Modal
Close Modal