Abstract

Lakes are one of the sinks of antibiotic-resistant bacteria (ARB) and antibiotic resistance genes (ARGs); however, information on ARB and ARGs in lakes in the Philippines is scarce. In this study, Escherichia coli was isolated from the largest freshwater lake in the Philippines, Laguna Lake, to detect antibiotic resistance and the presence of ARGs. Broth microdilution assay (BMA) and molecular identification of five environmentally prevalent ARGs (strA, blaCTX-M, blaSHV, blaTEM, and tetA) were performed. The majority (75.70%) of the isolates harbored at least one of the targeted antibiotic genes. Multiplex PCR detected about 49.07% of the isolates had genes for extended-spectrum β-lactamases (ESBL), which were mostly represented by blaTEM (47.66%). The genes strA and tetA were observed in this study with detection frequencies of 29.91 and 45.33%, respectively. About 95.69% of thermotolerant E. coli isolates were non-susceptible to six different antibiotics using BMA. Nearly 37% of the isolates were found to be multidrug-resistant (MDR) with most isolates resistant to ampicillin (81.72%). Furthermore, the occurrence of ESBL genes was significantly correlated with tetA genes (P = 0.013). To date, this study is the first to report on the presence of MDR and thermotolerant E. coli in Laguna Lake, Philippines.

HIGHLIGHTS

  • First report of the ecological presence of thermotolerant and multidrug-resistant Escherichia coli (37%) in Laguna Lake.

  • Most (75.70%) isolates harbored at least one of the targeted antibiotic resistance genes (strA, blaTEM, blaCTX-M, blaSHV, and tetA).

  • First report of the occurrence of aminoglycoside resistant gene (strA) and tetracycline efflux gene (tetA) in waterborne E. coli isolated in the Philippines.

Graphical Abstract

Graphical Abstract
Graphical Abstract

INTRODUCTION

In recent decades, the prevalent and inappropriate uses of antibiotics in clinical and agricultural practices have led to the accelerated occurrence of resistance to antibiotic compounds (Osińska et al. 2017; Amarasiri et al. 2020). Discharges from wastewater treatment plants, hospital, and farming practices have subsequently reached the environment (Yang et al. 2018). The aquatic environments became catch basins of antibiotic compounds, antibiotic-resistant bacteria (ARB), and antibiotic resistance genes (ARGs) (Osińska et al. 2017; Amarasiri et al. 2020). For several years, the prevalence of ARB and ARGs in marine water (Cuadrat et al. 2020), watershed (Cho et al. 2019), river (Harnisz et al. 2020; Yang et al. 2020), lakes (Liang et al. 2020; Yang et al. 2020), groundwater (Szekeres et al. 2018), and even in tap water (Yang et al. 2020) have been widely documented. This occurrence of ARB and ARGs in the aquatic environment has been associated with the rapid spread of antibiotic-resistant pathogens in animals and humans (Al Salah et al. 2019; Amarasiri et al. 2020). This phenomenon is a growing health concern that might expedite the creation of multidrug-resistant (MDR) microorganisms that might be challenging to eliminate (Amarasiri et al. 2020). Also, negative health outcomes, mortality, and high hospital cost are some consequences of infections with ARB (Thorpe et al. 2018; Dadgostar 2019).

Recently, surveillances have focused on lakes, since standing or slow-flowing bodies of water are highly probable to retain ARB and ARGs (Czekalski et al. 2015; Yang et al. 2018). In the Philippines, increasing rates of resistance were observed on laboratory-based surveillances (Argimón et al. 2020). However, studies on ARB and ARGs in lakes in the Philippines are limited. Laguna Lake (Laguna de Bay) is the largest inland freshwater lake in the Philippines with a surface area of about 900 km2 (Sta. Ana & Espino 2020). The lake is a significant zone for aquaculture, fisheries, industry, recreation and water source for irrigation and domestic uses (Fajardo & Ocampo 2018; Sta. Ana & Espino 2020). Sulfonamides and sulfamethoxazole resistance genes (sul 1, sul 2, and sul 3) were detected in selected sites in the lake in 2009 (Suzuki et al. 2013). Also, Vibrio and Salmonella spp. with phenotypic resistance to six antibiotics were detected in one of the river catchments of Laguna Lake (Ntabugi et al. 2020). However, little is known about the presence of antibiotic-resistant Escherichia coli in this lake.

E. coli is a clinically important Gram-negative bacterium commonly infecting both humans and animals. Some E. coli strains are harmless commensal of the gut, while some serotypes are pathogenic causing illness which includes diarrhea, urinary tract infections, respiratory illnesses, and sepsis, to name a few (Odonkor & Addo 2018; Swedan & Alrub 2019). It is a useful indicator species for microbial quality assessment, and its occurrence in the environment is highly associated with fecal contamination from warm-blooded animals (Odonkor & Addo 2018). It is recognized as a suitable indicator for antibiotic resistance (Liu et al. 2018; Odonkor & Addo 2018). It is documented to carry various ARGs (Poirel et al. 2018; Haberecht et al. 2019) and is identified with an increasing rate of resistance to antibiotics which include aminoglycosides, fluoroquinolone, and β-lactam antibiotics (De Oliveira et al. 2020). In addition, E. coli strains with co-resistance to extended-spectrum β-lactamase (ESBL), aminoglycosides, and tetracycline were documented in water sources (Tacão et al. 2014). In this study, the presence of antibiotic-resistant E. coli in Laguna Lake was investigated. This study also aimed to detect the presence of antibiotic genetic determinants for ESBL (blaCTX-M, blaSHV, and blaTEM), aminoglycoside (strA), and tetracycline (tetA) sampled from the surface water of Laguna Lake. Also, the co-occurrence of the selected genes was investigated.

MATERIALS AND METHODS

Sample collection

Laguna Lake as an important water source and catch basin of various rivers is consistently monitored by the Laguna Lake Development Authority (LLDA). There are 15 sampling lake stations established by the LLDA. In this study, water samples were collected from selected three sampling locations (Stations 2, 5, and 8). The stations were selected with the highest number of total coliforms based on the assessment of data acquired from the LLDA.

Station 2 is located at the east side of the lake; Station 5 is the sampling site nearest to Metro Manila; and Station 8 is on the South Bay (Figure 1). Water collection was done from October 2019 to January 2020 and March 2020. Approximately, 1 L of water samples were collected into sterile bottles and were immediately placed on ice, transported, and processed in the laboratory within 24–48 h.

Figure 1

Map showing locations of three sampling sites in Laguna Lake, Philippines. The inset shows the location of Laguna Lake in the Philippines.

Figure 1

Map showing locations of three sampling sites in Laguna Lake, Philippines. The inset shows the location of Laguna Lake in the Philippines.

Bacterial isolation

Isolation of thermotolerant E. coli was conducted using the membrane filtration method by the US EPA as previously described (Labrador et al. 2020). Approximately, 1 L of water samples were filtered through a filter membrane (47 mm filter diameter, 0.45 μm pore size; Pall Corp., USA) using a vacuum pump. The membrane filters were incubated on the modified membrane-thermotolerant agar (mTEC; BD Difco, USA) at 35 °C for 2 h and then incubated to 42 °C for 18–24 h. Presumptive isolates characterized by blue to violet colonies were transferred to eosin methylene blue agar (EMBA; BD BBL, USA) plates for confirmation. After incubation, green metallic sheen colonies were selected and grown overnight on trypticase soy broth (TSB; BD BBL, USA) at 35 °C for 18–24 h for further analysis. Separate tubes were also prepared in which glycerol (20%) was added after 18–24 h incubation for storage.

Genomic DNA extraction and molecular identification

To extract DNA, a simple boil-lysis method was employed (Garcia et al. 2015). Isolates were grown on TSB for 18–24 h and were concentrated through centrifugation at 10,000 × g for 10 min. The resulting pellet was washed in 1 mL distilled water through centrifugation at 10,000 × g for 10 min, which was then suspended in 100 μL sterile water and heated at 100 °C for 15 min. Supernatant was collected in sterile tubes and kept for further analysis. Presumptive E. coli isolates were confirmed genotypically using uidA gene primers, ECN1254F and ECN1328R (Frahm & Obst 2003), following PCR cycling conditions previously described (Table 1). PCR mixture consisted of 1× GoTaq® Green Mastermix (Promega, USA), 0.50 μM of forward and reverse primers, 1 μL of DNA template, and appropriate nuclease-free water for a total volume of 12 μL. A no template mix and E. coli ATCC 25922 DNA were used as negative and positive controls, respectively.

Table 1

Primers and cycling conditions for detection of ARGs

GeneAntibiotic classPrimers (5′-3′)PCR conditionAmplicon size (bp)Positive control
ECN – GCAAGGTGCACGGGAATATT
CAGGTGATCGGACGCGT 
2 min at 98 °C, 35 cycles of 30 s at 95 °C, annealing for 1 min at 63 °C, elongation for 1 min at 72 °C, and extension for 5 min at 72 °Ca 75 E. coli (ATCC EC25922) 
strA Aminoglycosides TCAATCCCGACTTCTTACCG
CACCATGGCAAACAACCATA 
5 min at 95 °C, 35 cycles of 30 s at 95 °C, annealing for 1 min at 54 °C, elongation for 1 min at 72 °C, and extension for 5 min at 72 °Cb 126 P15 
blaCTX-M β-lactams ATGTGCAGYACCAGTAARGTKATGGC
TGGGTRAARTARGTSACCAGAAYCAGC 
3 min at 95 °C, 29 cycles of 30 s at 95 °C, annealing for 30 s at 60 °C, elongation for 1 min at 72 °C, and extension for 10 min at 72 °Cc 593 Salmonella sp. 
blaTEM TCGCCGCATACACTATTCTCAGAATGA
ACGCTCACCGGCTCCAGATTTAT 
445 
blaSHV ATGCGTTATATTCGCCTGTG
TGCTTTGTTATTCGGGCCAA 
745 K. pneumoniae (ATCC 700603) 
tetA Tetracycline GCTACATCCTGCTTGCCTTC
CATAGATCGCCGTGAAGAGG 
5 min at 94 °C, 35 cycles of 1 min at 94 °C, annealing for 1 min at 57 °C, elongation for 1 min at 72 °C, and extension for 7 min at 72 °Cd 210 J596 (this study) 
GeneAntibiotic classPrimers (5′-3′)PCR conditionAmplicon size (bp)Positive control
ECN – GCAAGGTGCACGGGAATATT
CAGGTGATCGGACGCGT 
2 min at 98 °C, 35 cycles of 30 s at 95 °C, annealing for 1 min at 63 °C, elongation for 1 min at 72 °C, and extension for 5 min at 72 °Ca 75 E. coli (ATCC EC25922) 
strA Aminoglycosides TCAATCCCGACTTCTTACCG
CACCATGGCAAACAACCATA 
5 min at 95 °C, 35 cycles of 30 s at 95 °C, annealing for 1 min at 54 °C, elongation for 1 min at 72 °C, and extension for 5 min at 72 °Cb 126 P15 
blaCTX-M β-lactams ATGTGCAGYACCAGTAARGTKATGGC
TGGGTRAARTARGTSACCAGAAYCAGC 
3 min at 95 °C, 29 cycles of 30 s at 95 °C, annealing for 30 s at 60 °C, elongation for 1 min at 72 °C, and extension for 10 min at 72 °Cc 593 Salmonella sp. 
blaTEM TCGCCGCATACACTATTCTCAGAATGA
ACGCTCACCGGCTCCAGATTTAT 
445 
blaSHV ATGCGTTATATTCGCCTGTG
TGCTTTGTTATTCGGGCCAA 
745 K. pneumoniae (ATCC 700603) 
tetA Tetracycline GCTACATCCTGCTTGCCTTC
CATAGATCGCCGTGAAGAGG 
5 min at 94 °C, 35 cycles of 1 min at 94 °C, annealing for 1 min at 57 °C, elongation for 1 min at 72 °C, and extension for 7 min at 72 °Cd 210 J596 (this study) 

Detection of resistance genes

The presence of ARGs for aminoglycosides (strA) and tetracycline (tetA) was detected using singleplex PCR, while a multiplex PCR for β-lactams (blaTEM, blaCTX-M, and blaSHV) was performed in confirmed 214 thermotolerant E. coli isolates. Amplification was carried out using 2 μL of DNA, 1× GoTaq® Green Mastermix (Promega, USA), 1 μM of forward and reverse primers, and nuclease-free water following the PCR conditions described in Table 1. Appropriate controls were used for each run. For strA, blaCTX-M, and tetA genes, the positive controls were the isolates in this study, which were sequenced and confirmed with the deposited sequences in GenBank using the Basic Local Alignment Search Tool (BLAST).

After amplification, 3 μL of generated amplicons were separated on 2% agarose gel stained with SYBR® safe DNA gel stain (Invitrogen, USA) for 30 min at 280 V in Tris-Acetate-EDTA (TAE) buffer and visualized via the gel documentation system (Bio-Print ST4, Vilber Lourmat, UK). DNA ladders with sizes of 1 kb (KAPA Universal Ladder, Biosystem), 50, and 100 bp (Hyperladder Bioline) were used to estimate the molecular weights of the amplicons.

Antimicrobial susceptibility test

Phenotypic antibiotic resistance was determined by broth microdilution assay (BMA) as previously described (Stachowiak et al. 2010; Balouiri et al. 2016). Ninety-three selected isolates with the identified presence of β-lactams or tetracycline resistance genes were tested to six antibiotics covering four different antimicrobial classes: kanamycin (32 μg/mL) and streptomycin for aminoglycosides; ampicillin (10 μg/mL) for β-lactams; kanamycin (32 μg/mL) and streptomycin (20 μg/mL) for aminoglycosides, imipenem (10 μg/mL) for carbapenem; ciprofloxacin (5 μg/mL) for quinolones and tetracycline (30 μg/mL).

Isolates in EMBA were streaked to trypticase soy agar (TSA; BBL, USA) and cultured for 18–24 h at 35 °C. The cultures were adjusted to 0.5 McFarland turbidity standard, and approximately 200 μL of cultures were inoculated to a 96-well microtiter plate to make a master plate. Approximately, 50 μL of cultures from the master plates were transferred to separate microtiter plates containing 50 μL TSB supplemented with 50 μL individual antibiotics. Resistance was defined as growth and sensitive as no growth using observable turbidity as measurement. E. coli ATCC 25922, drug, and medium (TSB) only containing wells were also included as controls.

Statistical analysis

Frequency and graphs were generated using Microsoft Excel. Fisher's exact test was performed using SPSS v. 26 (SPSS Inc., Chicago, IL, USA) to establish an association among the tested antimicrobial-resistant genes. P-values of ≤0.05 were considered significant.

RESULTS AND DISCUSSION

The aquatic environment is recognized as reservoir of ARB and ARGs and is considered an important element for the transmission of antibiotic resistance (Osińska et al. 2017; Cho et al. 2019). As mentioned earlier, the occurrence of ARB and ARGs in the water system has been documented globally. Surveillance of ARB and ARGs is one of the efforts established in understanding the rise of resistance to antibiotic agents (Argimón et al. 2020). In this study, Laguna Lake was assessed for the occurrence of ARB and ARGs through the detection of thermotolerant E. coli isolates.

Two hundred and fourteen molecularly confirmed E. coli were isolated in three sampling stations. One hundred sixty-one (75.70%) were found to contain at least one of the target ARGs except for blaCTX-M (Table 2). Collectively, the ESBL blaTEM gene was dominantly observed among the five selected genes. The predominance of blaTEM was also observed in irrigation waters in the Philippines, where about 48% of isolates were positive for the gene (Vital et al. 2018). Also, blaTEM was more frequently observed in clinical isolates in Filipinos (Cruz & Hedreyda 2017).

Table 2

Occurrence of ARGs in water samples collected in three sampling sites

Sampling stations
Total (%)
n = 214
Antibiotic classTarget geneStation 2
n = 77
Station 5
n = 78
Station 8
n = 59
Aminoglycosides strA 48.05 13.43 24.53 29.91 
β-lactams blaCTX-M 0.00 0.00 0.00 0.00 
 blaSHV 12.99 5.97 3.77 7.88 
 blaTEM 51.95 71.64 20.75 47.66 
Tetracycline tetA 55.84 55.22 22.64 45.33 
Sampling stations
Total (%)
n = 214
Antibiotic classTarget geneStation 2
n = 77
Station 5
n = 78
Station 8
n = 59
Aminoglycosides strA 48.05 13.43 24.53 29.91 
β-lactams blaCTX-M 0.00 0.00 0.00 0.00 
 blaSHV 12.99 5.97 3.77 7.88 
 blaTEM 51.95 71.64 20.75 47.66 
Tetracycline tetA 55.84 55.22 22.64 45.33 

Among the ARB, the spread of ESBL-producing Enterobacteriaceae is identified as a primary concern of the World Health Organization (WHO) in 2015 (Ng & Gin 2019). From the ESBL-producing bacteria, the temoneira (TEM) β-lactamases are produced due to mutations in TEM, which are encoded by blaTEM genes (Bailey et al. 2011; Baniga et al. 2020). TEM types are capable of deactivating classes of penicillin drugs such as ampicillin (Bailey et al. 2011). Recent reports of TEM harboring E. coli isolates sampled from water sources (Osińska et al. 2017; Baniga et al. 2020) were consistent with the findings in this study. However, our findings seem to disagree with the recent report of isolates sampled from selected hospital sewers and rivers in the Philippines, wherein E. coli isolates were found to carry blaCTX-M genes (Suzuki et al. 2020). The variations in results of the prevalent ESBL types might be attributed to differences in sampling period and geographical locations (Vital et al. 2018).

Aminoglycosides are antibiotics that are frequently used in combination with β-lactams for the treatment of Gram-negative bacterial infections (Bodendoerfer et al. 2020). One mechanism of resistance of aminoglycosides involves the formation of enzymes, which modify the antibiotic drug at various sites (Bodendoerfer et al. 2020; Schaenzer & Wright 2020). The strA gene is one of the resistance genes that encode aminoglycoside-modifying enzyme, which confers resistance to streptomycin (Frye & Jackson 2013; Poirel et al. 2018). In this study, 29.91% of E. coli isolates were positive for strA genes (Table 2). To date, this is the first report of detection of strA gene in Philippine waters. Similar findings of the occurrence of strA gene were reported in waterborne (Gomi et al. 2017; Singh et al. 2021) and foodborne E. coli isolates (Zhang et al. 2014; Poirel et al. 2018) in several countries.

The presence of tetA gene against tetracycline was also detected in this study. It was shown that almost half of E. coli isolates have tetA gene (Table 2). A study on fruits, spices, and vegetables sourced from selected markets in the Philippines has found high prevalence of the tetA gene (30%) in E. coli isolates (Vital et al. 2017). To our knowledge, this present study is the first detection of tetA from Philippine waters. The tetA gene is commonly observed in aquatic environment (Cho et al. 2019; Liang et al. 2020), supporting the result of our study. Tetracyclines are generally applied on animals, and it was hypothesized that their presence in the aquatic system might indicate the contamination of ARGs from animal farming (Czekalski et al. 2015).

The coexistence of different ARGs within the same isolate has been established (Poirel et al. 2018; Bodendoerfer et al. 2020; Liang et al. 2020). The establishment of co-occurrence is significant for guiding combination therapy to limit resistance in antibiotic compounds (Bodendoerfer et al. 2020). In this study, significant association was observed between ESBL and tetA gene (Table 3). Similar significant co-resistance was observed between tetA+ and ESBL+ isolates in waterborne E. coli from other countries (Tacão et al. 2014). In contrast, our findings show no significant relationship of strA to tetA+ and ESBL+ isolates. Further study is warranted, since significant co-occurrence was observed with aminoglycosides genes aph(3′)-Ia or aac(3)-IId and blaTEM-1 in clinical isolates in the study of Bodendoerfer et al. (2020).

Table 3

Fisher's exact test results showing association among the ARGs

blastrAtetA
bla – 0.299 0.013* 
strA 0.299 – 0.374 
tetA 0.013* 0.374 – 
blastrAtetA
bla – 0.299 0.013* 
strA 0.299 – 0.374 
tetA 0.013* 0.374 – 

*Significant at P ≤ 0.05 (two-tailed).

In this present study, 93 ESBL+ and tetA+ isolates were selected from the 214 E. coli isolates for phenotypic characterization. The majority (95.69%) of the isolates exhibited at least one phenotypic resistance to the six antibiotics tested encompassing four different antibiotic classes. Most isolates were resistant to ampicillin, a β-lactam antibiotic, followed by streptomycin and tetracycline (Table 4). On the other hand, few isolates were observed to be nonselective to iminepem and ciprofloxacin (Table 4).

Table 4

Antibiotic resistant profile of isolated thermotolerant E. coli from Laguna Lake

Antibiotic agentDosage (μg/mL)Resistant isolates (%) n = 93
Kanamycin 32 18.28 
Streptomycin 20 62.36 
Ampicillin 10 81.72 
Iminepem 10 18.28 
Ciprofloxacin 11.82 
Tetracycline 30 29.03 
Antibiotic agentDosage (μg/mL)Resistant isolates (%) n = 93
Kanamycin 32 18.28 
Streptomycin 20 62.36 
Ampicillin 10 81.72 
Iminepem 10 18.28 
Ciprofloxacin 11.82 
Tetracycline 30 29.03 

Commonly, MDR bacteria are defined as having non-susceptibility to at least three or more antimicrobial categories (Osińska et al. 2017; van Spijk et al. 2019). Although the number of isolates was uneven in sampling locations, it is noteworthy that the presence of MDR was evident in all three sampling locations (Figure 2(a)–2(c)). Overall, 37% were MDR being non-susceptible to three or more antibiotics, and 39% were resistant to two antibiotics tested (Figure 2(d)). Similar observations were shown on E. coli strains from irrigation water collected in various areas of Metro Manila, Philippines. Paraoan et al. (2017) recorded 58.22% MDR isolates collected in Bulacan and 36.5% MDR isolates were documented from urban farms in different areas of Metro Manila (Vital et al. 2018). Furthermore, phenotypic assay has shown resistant E. coli isolates against β-lactams from isolates recovered from Lake Lanao, Philippines (Barosa et al. 2020). Taken together, although the pathogenicity of the sampled isolates in this study was not determined, our findings provided information on the occurrence of thermotolerant and MDR E. coli isolates in Laguna Lake.

Figure 2

MDR patterns of E. coli isolates in (a) Station 2 (n = 42), (b) Station 5 (n = 44), (c) Station 8 (n = 7), and (d) all sampling points.

Figure 2

MDR patterns of E. coli isolates in (a) Station 2 (n = 42), (b) Station 5 (n = 44), (c) Station 8 (n = 7), and (d) all sampling points.

CONCLUSION

This study isolated MDR E. coli in Laguna Lake. Isolates were found to be phenotypically resistant to four different antibiotic classes and were reservoir of four resistance genes (strA, blaSHV, blaTEM, and tetA) covering three different classes of antibiotic agents such as aminoglycosides, β-lactams, and tetracycline. The TEM carrying E. coli was highly observed among the isolates. Also, this is the first detection of strA+ and tetA+ E. coli isolates in Philippine waters. Furthermore, significant association between ESBL+ and tetA+ isolates was observed in this study. Taken together, these results are an addition to the growing evidence of the ecological presence of ARB and ARGs.

ACKNOWLEDGEMENTS

This work was supported financially by the Philippine Council for Industry, Energy and Emerging Technology Research and Development (PCIEERD) of the Department of Science and Technology (DOST). We thank our collaborating agency, the Laguna Lake Development Authority (LLDA), for the technical support. We are also grateful to the Microbial Source Tracking (MST) Research Group of the Pathogen-Host-Environment Interactions Research Laboratory (PHEIRL), Institute of Biology, College of Science, University of the Philippines Diliman for the technical assistance.

CONFLICT OF INTEREST

The authors declare that they have no conflicts of interest.

DATA AVAILABILITY STATEMENT

All relevant data are included in the paper or its Supplementary Information.

REFERENCES

Argimón
S.
,
Masim
M. A.
,
Gayeta
J. M.
,
Lagrada
M. L.
,
Macaranas
P. K. V.
,
Cohen
V.
,
Limas
M. T.
,
Espiritu
H. O.
,
Palarca
J. C.
,
Chilam
J.
,
Jamoralin
M. C.
,
Villamin
A. S.
,
Borlasa
J. B.
,
Olorosa
A. A.
,
Hernandez
L. F. T.
,
Boehme
K. D.
,
Jeffrey
B.
,
Abudahab
K.
,
Hufano
C. M.
,
Sia
S. B.
,
Stelling
J.
,
Holden
M. T. G.
,
Aanensen
D. M.
&
Carlos
C. C.
2020
Integrating whole-genome sequencing within the National Antimicrobial Resistance Surveillance Program in the Philippines
.
Nature Communications
11
,
2719
.
Bailey
J. K.
,
Pinyon
J. L.
,
Anantham
S.
&
Hall
R. M.
2011
Distribution of the blaTEM gene and blaTEM-containing transposons in commensal Escherichia coli
.
Journal of Antimicrobial Chemotherapy
66
,
745
751
.
Balouiri
M.
,
Sadiki
M.
&
Ibnsouda
S. K.
2016
Methods for in vitro evaluating antimicrobial activity: a review
.
Journal of Pharmaceutical Analysis
6
,
71
79
.
Baniga
Z.
,
Hounmanou
Y. M. G.
,
Kudirkiene
E.
,
Kusiluka
L. J. M.
,
Mdegela
R. H.
&
Dalsgaard
A.
2020
Genome-based analysis of extended-spectrum β-lactamase-producing Escherichia coli in the aquatic environment and Nile perch (Lates niloticus) of Lake Victoria, Tanzania
.
Frontiers in Microbiology
11
,
108
.
Barosa
N. C.
,
Amparado
B. B.
,
Kabirun
M. C.
&
Villarino
A. G.
2020
Antibiotic resistance profiling and evaluation of multiple antibiotic resistance (MAR) index of bacterial isolates from surface water of Lake Lanao, Philippines
.
International Journal of Pharma Medicine and Biological Sciences
9
,
75
80
.
Bodendoerfer
E.
,
Marchesi
M.
,
Imkamp
F.
,
Courvalin
P.
,
Böttger
E. C.
&
Mancini
S.
2020
Co-occurrence of aminoglycoside and β-lactam resistance mechanisms in aminoglycoside-non-susceptible Escherichia coli isolated in the Zurich area, Switzerland
.
International Journal of Antimicrobial Agents
56
,
106019
.
Cho
S.
,
Nguyen
H. A. T.
,
McDonald
J. M.
,
Woodley
T. A.
,
Hiott
L. M.
,
Barrett
J. B.
,
Jackson
C. R.
&
Frye
J. G.
2019
Genetic characterization of antimicrobial-resistant Escherichia coli isolated from a mixed-use watershed in northeast Georgia, USA
.
International Journal of Environmental Research and Public Health
16
,
3761
.
Cruz
M. C.
&
Hedreyda
C. T.
2017
Detection of plasmid-borne β-lactamase genes in extended-spectrum β-lactamase (ESBL) and non-ESBL-producing Escherichia coli clinical isolates
.
Philippine Journal of Science
146
,
167
175
.
Cuadrat
R. R.
,
Sorokina
M.
,
Andrade
B. G.
,
Goris
T.
&
Davila
A. M.
2020
Global ocean resistome revealed: exploring antibiotic resistance gene abundance and distribution in TARA Oceans samples
.
GigaScience
9
,
1
12
.
Czekalski
N.
,
Sigdel
R.
,
Birtel
J.
,
Matthews
B.
&
Bürgmann
H.
2015
Does human activity impact the natural antibiotic resistance background? Abundance of antibiotic resistance genes in 21 Swiss lakes
.
Environment International
81
,
45
55
.
Dadgostar
P.
2019
Antimicrobial resistance: implications and costs
.
Infection and Drug Resistance
12
,
3903
3910
.
De Oliveira
D. M.
,
Forde
B. M.
,
Kidd
T. J.
,
Harris
P. N.
,
Schembri
M. A.
,
Beatson
S. A.
,
Patterson
D. L.
&
Walker
M. J.
2020
Antimicrobial resistance in ESKAPE pathogens
.
Clinical Microbiology Reviews
33
,
1
49
.
Di Cesare
A.
,
Eckert
E. M.
,
Teruggi
A.
,
Fontaneto
D.
,
Bertoni
R.
,
Callieri
C.
&
Corno
G.
2015
Constitutive presence of antibiotic resistance genes within the bacterial community of a large subalpine lake
.
Molecular Ecology
24
,
3888
3900
.
Fajardo
L. J.
&
Ocampo
P. P.
2018
Inhibition of acetylcholinesterase activities in whitegoby, Glossogobius giuris from the East Bay of Laguna Lake, Philippines
.
International Journal of Agricultural Technology
14
,
1181
1192
.
Garcia
B. C. B.
,
Dimasupil
M. A. Z.
,
Vital
P. G.
,
Widmer
K. W.
&
Rivera
W. L.
2015
Fecal contamination in irrigation water and microbial quality of vegetable primary production in urban farms of Metro Manila, Philippines
.
Journal of Environmental Science and Health, Part B
50
,
734
743
.
Gomi
R.
,
Matsuda
T.
,
Matsumura
Y.
,
Yamamoto
M.
,
Tanaka
M.
,
Ichiyama
S.
&
Yoneda
M.
2017
Whole-genome analysis of antimicrobial-resistant and extraintestinal pathogenic Escherichia coli in river water
.
Applied and Environmental Microbiology
83
,
e2703-16
.
Haberecht
H. B.
,
Nealon
N. J.
,
Gilliland
J. R.
,
Holder
A. V.
,
Runyan
C.
,
Oppel
R. C.
,
Ibrahim
H. M.
,
Mueller
M.
,
Schrupp
F.
,
Vilchez
S.
,
Antony
L.
,
Scaria
J.
&
Ryan
E. P.
2019
Antimicrobial-resistant Escherichia coli from environmental waters in Northern Colorado
.
Journal of Environmental and Public Health
2019
,
3862949
.
Harnisz
M.
,
Kiedrzyńska
E.
,
Kiedrzyński
M.
,
Korzeniewska
E.
,
Czatzkowska
M.
,
Koniuszewska
I.
,
Jozwik
A.
,
Szklarek
S.
,
Niestepski
S.
&
Zalewski
M.
2020
The impact of WWTP size and sampling season on the prevalence of antibiotic resistance genes in wastewater and the river system
.
Science of the Total Environment
741
,
140466
.
Labrador
K. L.
,
Nacario
M. A. G.
,
Malajacan
G. T.
,
Abello
J. J. M.
,
Galarion
L. H.
,
Rensing
C.
&
Rivera
W. L.
2020
Selecting rep-PCR markers to source track fecal contamination in Laguna Lake, Philippines
.
Journal of Water and Health
18
,
19
29
.
Liang
X.
,
Guan
F.
,
Chen
B.
,
Luo
P.
,
Guo
C.
,
Wu
G.
,
Ye
Y.
,
Zhou
Q.
&
Fang
H.
2020
Spatial and seasonal variations of antibiotic resistance genes and antibiotics in the surface waters of Poyang Lake in China
.
Ecotoxicology and Environmental Safety
196
,
110543
.
Monstein
H. J.
,
Östholm-Balkhed
Å.
,
Nilsson
M. V.
,
Nilsson
M.
,
Dornbusch
K.
&
Nilsson
L. E.
2007
Multiplex PCR amplification assay for the detection of blaSHV, blaTEM and blaCTX-M genes in Enterobacteriaceae
.
APMIS
115
,
1400
1408
.
Ng
L.-K.
,
Martin
I.
,
Alfa
M.
&
Mulvey
M.
2001
Multiplex PCR for the detection of tetracycline resistant genes
.
Molecular and Cellular Probes
15
,
209
215
.
Ntabugi
K. M.-M.
,
Manegabe
B. J.
,
Dewar
J. B.
,
Simbahan
J. F.
,
Flavier
M. E.
&
Sekomo
C. B.
2020
Synergistic increase in antibiotic resistance with tolerance to cadmium and lead in environmental bacteria isolated from the San Cristobal River, Laguna De Bay, Philippines
.
International Journal of Environmental Studies
78
,
1
19
.
Odonkor
S. T.
&
Addo
K. K.
2018
Prevalence of multidrug-resistant Escherichia coli isolated from drinking water sources
.
International Journal of Microbiology
2018
,
1
8
.
Poirel
L.
,
Madec
J.-Y.
,
Lupo
A.
,
Schink
A.-K.
,
Kieffer
N.
,
Nordmann
P.
&
Schwarz
S.
2018
Antimicrobial resistance in Escherichia coli
.
Microbiology Spectrum
6
(
4
),
ARBA-0026-2017
.
Schaenzer
A. J.
&
Wright
G. D.
2020
Antibiotic resistance by enzymatic modification of antibiotic targets
.
Trends in Molecular Medicine
8
,
768
782
.
Sta. Ana
K. M.
&
Espino
M. P. B.
2020
Occurrence and distribution of hormones and bisphenol A in Laguna Lake, Philippines
.
Chemosphere
256
,
127122
.
Stachowiak
M.
,
Clark
S. E.
,
Templin
R. E.
&
Baker
K. H.
2010
Tetracycline-resistant Escherichia coli in a small stream receiving fish hatchery effluent
.
Water, Air, & Soil Pollution
211
,
251
259
.
Suzuki
Y.
,
Nazareno
P. J.
,
Nakano
R.
,
Mondoy
M.
,
Nakano
A.
,
Bugayong
M. P.
,
Bilar
J.
,
Perez
M.
,
Medina
E. J.
,
Saito-Obata
M.
,
Saito
M.
,
Nakashima
K.
,
Oshitani
H.
&
Yano
H.
2020
Environmental presence and genetic characteristics of carbapenemase-producing Enterobacteriaceae from hospital sewage and river water in the Philippines
.
Applied and Environmental Microbiology
86
,
e01906-19
.
Szekeres
E.
,
Chiriac
C. M.
,
Baricz
A.
,
Szőke-Nagy
T.
,
Lung
I.
,
Soran
M.-L.
,
Rudi
K.
,
Dragos
N.
&
Coman
C.
2018
Investigating antibiotics, antibiotic resistance genes, and microbial contaminants in groundwater in relation to the proximity of urban areas
.
Environmental Pollution
236
,
734
744
.
Tacão
M.
,
Moura
A.
,
Correia
A.
&
Henriques
I.
2014
Co-resistance to different classes of antibiotics among ESBL-producers from aquatic systems
.
Water Research
48
,
100
107
.
van Spijk
J. N.
,
Schmitt
S.
&
Schoster
A.
2019
Infections caused by multidrug-resistant bacteria in an equine hospital (2012–2015)
.
Equine Veterinary Education
31
,
653
658
.
Vital
P. G.
,
Caballes
M. B. D.
&
Rivera
W. L.
2017
Antimicrobial resistance in Escherichia coli and Salmonella spp. isolates from fresh produce and the impact to food safety
.
Journal of Environmental Science and Health, Part B
52
,
683
689
.
Vital
P. G.
,
Zara
E. S.
,
Paraoan
C. E. M.
,
Dimasupil
M. A. Z.
,
Abello
J. J. M.
,
Santos
I. T. G.
&
Rivera
W. L.
2018
Antibiotic resistance and extended-spectrum beta-lactamase production of Escherichia coli isolated from irrigation waters in selected urban farms in Metro Manila, Philippines
.
Water
10
,
548
.
Yang
Y.
,
Song
W.
,
Lin
H.
,
Wang
W.
,
Du
L.
&
Xing
W.
2018
Antibiotics and antibiotic resistance genes in global lakes: a review and meta-analysis
.
Environment International
116
,
60
73
.
Yang
J.
,
Wang
H.
,
Roberts
D. J.
,
Du
H.-N.
,
Yu
X.-F.
,
Zhu
N.-Z.
&
Meng
X.-Z.
2020
Persistence of antibiotic resistance genes from river water to tap water in the Yangtze River Delta
.
Science of the Total Environment
742
,
140592
.
Zhang
F. Y.
,
Huo
S. Y.
,
Li
Y. R.
,
Xie
R.
,
Wu
X. J.
,
Chen
L. G.
&
Gao
Y. H.
2014
A survey of the frequency of aminoglycoside antibiotic-resistant genotypes and phenotypes in Escherichia coli in broilers with septicaemia in Hebei, China
.
British Poultry Science
55
,
305
310
.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Licence (CC BY-NC-ND 4.0), which permits copying and redistribution for non-commercial purposes with no derivatives, provided the original work is properly cited (http://creativecommons.org/licenses/by-nc-nd/4.0/).