Microbial water-borne diseases still affect developing countries and are major water quality concerns throughout the world. Routine culture-based methods of identifying bacterial pathogens in water sources are laborious and time-consuming. Recently, the use of molecular techniques such as the polymerase chain reaction (PCR) has provided rapid and highly promising detection methods. In this study, we developed two multiplex PCR assays for simultaneous detection of six water-borne bacteria. Two triplex PCR protocols were developed to detect six target genes. The first protocol targets uidA (Escherichia coli), int (Shigella spp.), and gyrB (Pseudomonas aeruginosa) genes, while invA (Salmonella spp.), ompW (Vibrio cholera), and lacZ (coliforms) were amplified by the second protocol. Specificity testing was carried out for 12 reference strains. Furthermore, the applicability of the multiplex PCR assays for detection of these bacteria was investigated for 52 surface water samples. The results indicated that all primer pairs showed specificities only for their corresponding target organisms. The detection sensitivity of both multiplex PCR assays was 3 × 102 − 3 × 103 colony forming units. The developed assays represent simple and efficient diagnostic procedures for co-detection of water-borne bacteria and have the potential to provide earlier warnings of possible public health threats and more accurate surveillance of these organisms.

INTRODUCTION

Water-borne pathogens that cause gastroenteritis remain a major global health concern and are one of the most common infectious causes of morbidity and mortality worldwide (Khan et al. 2000). Water sources, drinking water supply systems and treated drinking water can become contaminated with naturally occurring microbes or toxins, but may also be the targets of sabotage and intentional contamination. Microbial agents that may be utilized in intentional contamination of drinking water comprise naturally occurring enteropathogens, eradicated or uncommon pathogens, genetically modified bacteria or viruses or microbial toxins (Kortepeter and Parker 1999; Nicolson 2002). In theory, any microbe or microbial toxin possessing the potency to cause illness or a disorder in humans can be used as a bacterial agent against a target population through the drinking water supply. Thus, regular monitoring of water-borne microbes is required to protect public health (Nicolson 2002).

Conventional diagnostic procedures for routine detection of water-borne bacteria such as Escherichia coli, Salmonella spp., Shigella spp., and Vibrio cholera involve enrichment steps, selective culture, biochemical identification, and serotyping (Rundell et al. 2014). These steps are laborious, tedious, time-consuming, and low throughput, often taking several days to get a final result. Furthermore, several pathogens cannot be distinguished from normal flora by morphology and biochemical properties. Other pathogens are either difficult to culture or non-culturable, but can still cause illnesses (APHA/AWWA/WEF 2012; Luyt et al. 2012). In comparison with conventional culture-based methods, molecular methods are more rapid and offer sensitive detection, and can potentially be adapted by health authorities to improve water quality monitoring (Alhamlan et al. 2015). The main advantage of microbial identification by genetic markers is the relative stability of the genotype rather than the phenotype (Alhamlan et al. 2015). Amongst molecular approaches, the polymerase chain reaction (PCR) is currently the most frequently used technique because of its versatility, high specificity and sensitivity. In this regard, it is possible to selectively amplify a fragment of DNA that has a sequence shared only by particular species or strains. However, if a single primer set is used (uniplex PCR), a large number of individual PCR assays would be necessary to detect all bacteria of interest, leading to a relatively laborious, costly, and time-consuming process. Recently, the use of multiplex PCR has provided a rapid, specific, and highly sensitive method for co-detection of water-borne pathogens in aquatic environments (Alhamlan et al. 2015; Ramírez-Castillo et al. 2015).

In this study, we have developed and applied two high-throughput multiplex PCR assays for simultaneous detection of six different water-borne bacteria including E. coli, coliforms, Pseudomonas aeruginosa, Shigella spp., Salmonella spp., and Vibrio cholerae.

METHODS

Bacterial strains, culture conditions, and DNA extraction

For development and optimization of the PCR assays, Salmonellatyphimurium (American Type Culture Collection 14028), E. coli (ATCC 25922), Vibrio cholerae (ATCC 14035), Pseudomonas aeruginosa (ATCC 27853), Shigella sonnei (ATCC 9290), as well as 12 type strains (as negative controls) were purchased from the Iranian Research Organization for Science and Technology (IROST). All of the bacterial strains were cultured in the appropriate media (BHI broth) and under optimal growth condition (37 °C, aerobic), according to the IROST recommendations. Following overnight incubation, the optical density of bacterial cultures was adjusted to a 1 McFarland standard. Then, 10 ml of the cultures were centrifuged at 2,500 rpm for 15 min. The supernatant was discarded and genomic DNA was extracted from the bacterial pellet using an AccuPrep® Genomic DNA Extraction Kit (Bioneer, South Korea).

PCR primer design

Highly conserved regions within the genome of corresponding bacterial pathogens were chosen as target genes, including uidA (encoding for β-glucuronidase, specific for E. coli), int (encoding for putative integrase, specific for Shigella spp.), gyrB (encoding for DNA gyrase subunit B, specific for Pseudomonas aeruginosa), lacZ (encoding for β-galactosidase, specific for coliforms), invA (encoding for type III secretion system protein InvA, specific for Salmonella spp.), and ompW (encoding for outer membrane protein W, specific for Vibrio cholerae).

A total of six sets of primers were designed using Allele ID v7.6 software (PREMIER Biosoft, USA) based on available data from GenBank® (www.ncbi.nlm.nih.gov/genbank). We also used Primer-BLAST (http://www.ncbi.nlm.nih.gov/tools/primer-blast/) to confirm lack of DNA homology in bacterial species other than the mentioned pathogens. The sequences and amplicon sizes of the primers are shown in Tables 1 and 2.

Table 1

List of gene-specific PCR primers for the first protocol

Target microorganismTarget genePrimer sets (5′ to 3′)Annealing temperature (°C)Amplicon size (bp)Primer concentration (pmol)
E. coli uidA GAACTGGCAGACTATC 60 1,103 
CGTATTCGGTGATGAT 
Shigella sonnei int GCTGGATGAACGATGTCCAC 60 356 
ATCTGGCGGCTATGAGATGG 
Pseudomonas aeruginosa gyrB CAAGGGCAAGATCCTCAAC 60 217 
CATCTGGCGGAAGAAGAAG 
Target microorganismTarget genePrimer sets (5′ to 3′)Annealing temperature (°C)Amplicon size (bp)Primer concentration (pmol)
E. coli uidA GAACTGGCAGACTATC 60 1,103 
CGTATTCGGTGATGAT 
Shigella sonnei int GCTGGATGAACGATGTCCAC 60 356 
ATCTGGCGGCTATGAGATGG 
Pseudomonas aeruginosa gyrB CAAGGGCAAGATCCTCAAC 60 217 
CATCTGGCGGAAGAAGAAG 
Table 2

List of gene-specific PCR primers for the second protocol

Target microorganismTarget genePrimer sets (5′ to 3′)Annealing temperature (°C)Amplicon size (bp)Primer concentration (pmol)
Vibrio cholerae ompW TTAACGCTTGGCTATATGTT 60 345 
GAGGAACCAGCTATCATTG 
Salmonella typhimurium invA GGCGATAGCGATAATATG 60 500 
AAATAGACCGTAAATTGTTCA 
Coliforms lacZ TGAAGCAGAACAACTTTA 60 600 
CATATTTAATCAGCGACTG 
Target microorganismTarget genePrimer sets (5′ to 3′)Annealing temperature (°C)Amplicon size (bp)Primer concentration (pmol)
Vibrio cholerae ompW TTAACGCTTGGCTATATGTT 60 345 
GAGGAACCAGCTATCATTG 
Salmonella typhimurium invA GGCGATAGCGATAATATG 60 500 
AAATAGACCGTAAATTGTTCA 
Coliforms lacZ TGAAGCAGAACAACTTTA 60 600 
CATATTTAATCAGCGACTG 

Uniplex and multiplex PCR assays

The PCR assays were optimized using a Veriti® 96-Well Thermal Cycler (Applied Biosystems). For uniplex PCR assays, 2X PCR Master Mix (CinnaGen, Iran), different concentrations of primer sets (2–10 pmols) (all synthesized by Bioneer, South Korea), 1 μl of genomic DNA (approximately 100 ng/μl), and double-distilled water to a total volume of 20 μl was used. The PCR conditions were as follows: denaturation at 95 °C for 5 min, annealing at 58 °C to 63 °C (depending on the primer sets), 1 min at 72 °C, and a final extension at 72 °C for 7 min. The reactions resulted in a 1103-bp fragment for uidA (E. coli), a 600-bp fragment for lacZ (coliforms), a 217-bp fragment for gyrB (Pseudomonas aeruginosa), a 356-bp fragment for int (Shigella sonnei), a 500-bp fragment for invA (Salmonella typhimurium), and a 345-bp fragment for ompW (Vibrio cholerae).

For multiplex PCR assays, two protocols were designed: the first protocol targets uidA, int, and gyrB, while invA, ompW, and lacZ were amplified by the second protocol. The multiplex PCR reactions consisted of AccuPower® HotStart PCR PreMix (containing a thermostable DNA polymerase, pyrophosphatase, reaction buffer, dNTPs, tracking dye, and a patented stabilizer), different concentrations of primer sets (2–10 pmols) (Bioneer, South Korea), 1 μL (approximately 100 ng/μl) of genomic DNA, and double-distilled water to a total volume of 20 μl. The PCR condition used was as follows: denaturation at 95 °C for 5 min, followed by 30 cycles of 30 s at 94 °C, 40 s at 60 °C (for both protocols), 1 min at 72 °C, and a final extension at 72 °C for 7 min. All PCR products were evaluated by electrophoresis in 1.5% agarose gel containing SYBR green and visualized by a Gel Doc™ XR+ (BIORAD).

Sensitivity and specificity of primer sets

In order to evaluate the sensitivity of the multiplex PCR assays, suspension of type strains in Luria-Bertani broth (incubated for 18 h) were centrifuged at 2,500 rpm for 15 min, and washed with phosphate buffered saline (PBS). The bacterial pellet was suspended in distilled water and adjusted to a 1 McFarland standard. A 10-fold serial dilution with sterile distilled water was performed for eight consecutive concentrations (3 × 108 to 3 × 101 CFU/ml). Twenty ml of the serial dilutions (20 × 3 × 108 to 20 × 3 × 101 CFU) were subjected to an AccuPrep® Genomic DNA Extraction Kit (Bioneer, South Korea), and extracted DNA was dissolved in 20 μl elution water, yielding 3 × 108 to 3 × 101 copies of DNA in 1 μl of eluted water. One μl of DNA for each pathogen was subsequently mixed together and used as a template for the PCR. The multiplex and uniplex PCR assays were performed simultaneously for the same dilution series, by using the same PCR machine and in the same program as described above. All PCR products were evaluated by electrophoresis in 1.5% agarose gel containing SYBR green and visualized under ultraviolet light.

Analysis of spiked water

To spike, bacterial suspensions of Salmonellatyphimurium (ATCC 14028), E. coli (ATCC 25922), Vibrio cholerae (ATCC 14035), Pseudomonas aeruginosa (ATCC 27853), and Shigella sonnei (ATCC 9290) were adjusted to an optical density equivalent to a 1 McFarland standard. Ninety-nine ml of sterile PBS was inoculated with 1 ml of the bacterial suspensions yielding a concentration of 3 × 106 CFU/ml for each type strain. Ten ml of the spiked water was centrifuged at 2,500 rpm for 15 min and genomic DNA was extracted using an AccuPrep® Genomic DNA Extraction Kit.

Analysis of environmental samples

In order to evaluate the applicability of the multiplex PCR assays, we applied them to detect the mentioned bacteria in surface water samples. Following daily sampling, 52 surface water samples were collected from the Karaj River with geographic coordinates of 35°48′46.48″N; 51°0′43.03″E, between July and August 2015. Sampling bottles were immediately placed in a lightproof insulated box containing icepacks to ensure rapid cooling. The samples were shipped to the central laboratory of the Alborz Province Water and Wastewater Co. In order to validate the PCR results, all samples underwent the culture-based tests. For culture-based tests, conventional methods according to Standard Methods for the Examination of Water and Wastewater 22nd edition were used. All samples were analyzed for the presence of E. coli (method 9221), coliforms (method 9221), Pseudomonas aeruginosa (method 9213 F), Shigella spp. (method 9260 E), Salmonella spp. (method 9260 B), and Vibrio cholerae (method 9260 H) (APHA).

Since the number of bacteria in the water samples is not high enough for DNA extraction, samples were enriched in a highly boosting medium using GN enrichment broth (Merck KGaA). Experiments were conducted in 250 ml bottles containing 50 ml of 3X GN enrichment broth and 100 ml of water sample at 37 °C in a shaking incubator at 180 rpm for 12 hours. Confirming the turbidity, 50 ml of the sample was transferred into a 50 ml Falcon tube and centrifuged at 2,500 rpm for 15 min. Supernatant was discarded and genomic DNA was extracted using an AccuPrep® Genomic DNA Extraction Kit.

RESULTS

Specificity of multiplex PCR assays

Following the optimization of primer set concentrations in multiplex PCR assays (Tables 1 and 2), the specificity of each primer set was also evaluated. For two protocols of the multiplex PCR, each corresponding DNA and combinations of all DNA were amplified successfully without non-specific bands (Figure 1). Each PCR product could be observed as a clear band at 1,103, 600, 217, 504, 356, 500, and 345 bp generated by uidA, lacZ, gyrB, int, invA, and ompW primer sets, respectively. In addition to the above-mentioned bacteria, genomic DNA was also extracted from reference strains (listed in Table 3) and used as a template in the PCR assays. Lack of amplifications for these bacterial strains confirms the high specificity of the newly designed primer sets.
Table 3

Specificity of the primer sets

 PCR results
Reference strainsECShSaVP
Enterococcus faecalis ATCC 29212 (PTCC 1778) − − − − − − 
Enterococcus faecalis ATCC 19433 (PTCC 1774) − − − − − − 
Proteus vulgaris PTCC 1079 − − − − − − 
Pseudomonas putida ATCC 12633 (PTCC 1694) − − − − − − 
Serratia marcescens ATCC 13880 (PTCC 1621) − − − − − − 
Staphylococcus aureus ATCC 25923 (PTCC 1431) − − − − − − 
Streptococcus pyogenes ATCC 19615 (PTCC 1762) − − − − − − 
Bacillus cereus ATCC 11778 (PTCC 1015) − − − − − − 
Salmonella typhi PTCC 1609 − − − − − 
Enterobacter aerogenes ATCC 13048 (PTCC 1221) − − − − − 
E. coli NCIMB 11032 (PTCC 1395) − − − − 
Vibrio cholerae PTCC 1611 − − − − − 
 PCR results
Reference strainsECShSaVP
Enterococcus faecalis ATCC 29212 (PTCC 1778) − − − − − − 
Enterococcus faecalis ATCC 19433 (PTCC 1774) − − − − − − 
Proteus vulgaris PTCC 1079 − − − − − − 
Pseudomonas putida ATCC 12633 (PTCC 1694) − − − − − − 
Serratia marcescens ATCC 13880 (PTCC 1621) − − − − − − 
Staphylococcus aureus ATCC 25923 (PTCC 1431) − − − − − − 
Streptococcus pyogenes ATCC 19615 (PTCC 1762) − − − − − − 
Bacillus cereus ATCC 11778 (PTCC 1015) − − − − − − 
Salmonella typhi PTCC 1609 − − − − − 
Enterobacter aerogenes ATCC 13048 (PTCC 1221) − − − − − 
E. coli NCIMB 11032 (PTCC 1395) − − − − 
Vibrio cholerae PTCC 1611 − − − − − 

PTCC: Persian Type Culture Collection.

E: E. coli-specific primers.

C: Coliform-specific primers.

Sh: Shigella spp.-specific primers.

Sa: Salmonella spp.-specific primers.

V: Vibrio cholerae-specific primers.

P: Pseudomonas aeruginosa-specific primers.

+, Positive PCR result.

−, Negative PCR result.

Figure 1

Gel agarose analysis of uniplex and multiplex PCR protocols of spiked water. Lane 1, Enterococcus faecalis (ATCC 29212) as negative control; Lane 2, Pseudomonas putida (ATCC 12633) as negative control; Lane 3, gyrB for Pseudomonas aeruginosa (ATCC 27853) (217 bp); Lane 4, int for Shigella sonnei (ATCC 9290) (356 bp); Lane 5, uidA for E. coli (ATCC 25922) (1103 bp); Lane 6, triplex for gyrB, int, and uidA; Lane 7, DNA 100 bp ruler (Thermo Scientific); Lane 8, lacZ for E. coli (ATCC 25922) (600 bp); Lane 9, invA for Salmonella typhimurium (ATCC 14028) (500 bp); Lane 10, ompW for Vibrio cholera (ATCC 14035) (345 bp), and Lane 11, triplex for invA, ompW, and lacZ; Lane 12, blank (nothing loaded).

Figure 1

Gel agarose analysis of uniplex and multiplex PCR protocols of spiked water. Lane 1, Enterococcus faecalis (ATCC 29212) as negative control; Lane 2, Pseudomonas putida (ATCC 12633) as negative control; Lane 3, gyrB for Pseudomonas aeruginosa (ATCC 27853) (217 bp); Lane 4, int for Shigella sonnei (ATCC 9290) (356 bp); Lane 5, uidA for E. coli (ATCC 25922) (1103 bp); Lane 6, triplex for gyrB, int, and uidA; Lane 7, DNA 100 bp ruler (Thermo Scientific); Lane 8, lacZ for E. coli (ATCC 25922) (600 bp); Lane 9, invA for Salmonella typhimurium (ATCC 14028) (500 bp); Lane 10, ompW for Vibrio cholera (ATCC 14035) (345 bp), and Lane 11, triplex for invA, ompW, and lacZ; Lane 12, blank (nothing loaded).

Sensitivity of multiplex PCR assays

The sensitivity of the uniplex and multiplex PCR assays was subsequently examined in 10-fold serial dilutions of bacterial DNA mixtures. The sensitivity of the uniplex PCR for each primer was (approximately) 3 × 10 − 3 × 102 CFU of bacteria per ml (data not shown). As shown in Figure 2, a detection limit of 3 × 102 − 3 × 103 CFU was noted for mixtures of all primers in both multiplex PCR assays. Although the infectious concentrations varied between pathogens, it is generally believed that most bacterial pathogens can cause infection when more than 103 infectious cells are ingested (Ramírez-Castillo et al. 2015). Hence, the detection limit of the multiplex assays described in this study was within the infectious doses of most enteric pathogens.
Figure 2

Gel agarose analysis of two multiplex PCRs with a serial 10-fold dilution of mixed bacterial suspensions. Lane MW, DNA 100 bp ruler (Thermo Scientific); Lanes 1 to 8, first triplex PCR with DNA concentration from 3 × 108 to 3 × 101 CFU/ml. Lane 9, blank (nothing loaded). Lanes 10 to 17, triplex PCR with DNA concentration from 3 × 108 to 3 × 101 CFU/ml. As shown in this figure, a detection limit of 3 × 102–3 × 103 CFU/ml was noted for mixtures of all primers in two multiplex PCR protocols.

Figure 2

Gel agarose analysis of two multiplex PCRs with a serial 10-fold dilution of mixed bacterial suspensions. Lane MW, DNA 100 bp ruler (Thermo Scientific); Lanes 1 to 8, first triplex PCR with DNA concentration from 3 × 108 to 3 × 101 CFU/ml. Lane 9, blank (nothing loaded). Lanes 10 to 17, triplex PCR with DNA concentration from 3 × 108 to 3 × 101 CFU/ml. As shown in this figure, a detection limit of 3 × 102–3 × 103 CFU/ml was noted for mixtures of all primers in two multiplex PCR protocols.

Application to environmental and spiked samples

As described earlier, we applied both multiplex PCR assays and culture-based tests for 52 environmental samples. In this regard, multiplex PCR assays showed that all of the Karaj River samples contained coliforms, E. coli, Shigella spp., Salmonella spp., and P. aeruginosa. However, only two out of 52 samples were contaminated with V. cholerae. Results of culture-based examinations justified the PCR assays, since exactly the same results were obtained, which confirms the excellent and ideal consistency and association between these methods (Table 4). Furthermore, for the spiked sample, all target genes were detected (Figure 2). These promising results proved the possibility of assessing six different types of bacteria in actual and artificial water matrices within just 16 hours (12 hours for enrichment and 4 hours for PCR assay).

Table 4

Number of samples and positive results

StrainNumber of samplesCP
Coliforms 52 52 52 
E. coli 52 52 52 
Shigella spp. 52 52 52 
Salmonella spp. 52 52 52 
P. aeruginosa 52 52 52 
V. cholerae 52 
StrainNumber of samplesCP
Coliforms 52 52 52 
E. coli 52 52 52 
Shigella spp. 52 52 52 
Salmonella spp. 52 52 52 
P. aeruginosa 52 52 52 
V. cholerae 52 

C: No. of positive results through culture-based examinations.

P: No. of positive results through PCR assays.

DISCUSSION

In this study, we demonstrated a good level of correlation between the results of culture-based tests and multiplex PCR assays for detection of water-borne pathogens. Currently, there is no unified method to collect, process, and analyse water samples for all pathogenic microorganisms of interest (Bitton 2014; WHO 2014; Zhao et al. 2014). In addition, a number of problems are encountered in detection of pathogens in water sources such as low concentration of pathogens; this usually requires enrichment of the samples prior to detection processing, and the presence of inhibitors in water samples, including humic acids and metals (Bitton 2014). Furthermore, since some water-borne pathogens exist in a viable but non-culturable (VBNC) state, false negative results may arise from culture-based methods. Therefore, the number of pathogens in this state could be underestimated and, if all of the microorganisms in the sample are in the VBNC state, the sample may be regarded as pathogen-free due to non-detection (Li et al. 2014).

To overcome the limitations of culture-based methods, molecular approaches have been developed to identify the microorganisms. These approaches, including PCR, have the advantages of quick analysis and higher sensitivity compared to the traditional culture-based methods (Ramírez-Castillo et al. 2015). However, if a single primer set is used (uniplex PCR), a large number of individual PCR assays would be necessary to detect all bacteria of interest, which can be a relatively laborious, costly, and time-consuming process. Because of this, multiplex PCR has been developed for co-detection of pathogens. It involves the simultaneous amplification of more than one target gene per reaction by multiple primer sets with different specificities. The resulting PCR amplicons of different molecular weight can be separated by agarose gel electrophoresis. The expense in terms of reagents and preparation time is lower in multiplex PCR than in systems where several tubes of uniplex PCRs are used. Using multiplex PCR, it is possible to directly detect several pathogens at the same time in a single test, and existing problems associated with conventional culture methods can be avoided (Abd-El-Haleem et al. 2003).

These numerous advantages have made multiplex PCR the method of choice for researchers. For instance, Tsen et al. developed a multiplex PCR assay for detection of heat-labile toxin I and heat-stable toxin II genes of enterotoxigenic E. coli (ETEC) in skim milk and porcine stools (Tsen et al. 1998). Si Hong Park et al. designed and developed a protocol by which Campylobacter spp., Escherichia coli O157:H7, and Salmonella serotypes would be detected in a single tube (Park et al. 2011). Park et al. showed such protocols would reduce the time of detection from 48 hours with culturing to 4 hours with the multiplex PCR. In another study, Wei et al. applied a multiplex PCR assay for rapid detection of Pasteurella multocida, Salmonella enterica, Riemerella anatipestifer, and Escherichia coli in ducks (Wei et al. 2013). Wei et al. believed that distinguishing these pathogens based on clinical signs would be difficult because these pathogens can cause similar clinical signs and co-infections can occur, and concluded that the best method to detect and differentiate these bacteria is by multiplex PCR. In addition to conventional PCR, real-time PCR-based approaches for accurate quantification of bacterial RNA targets in water have also been developed. In this regard, Fey et al. succeeded in quantifying DNA with high accuracy and sensitivity from environmental water samples (Fey et al. 2004). In another study conducted by Huang et al., a quadruplex real-time PCR assay was developed for detection and identification of Vibrio cholerae O1 and O139 strains and determination of their toxigenic potential (Huang et al. 2009).

In the present study, six primer sets were designed to simultaneously detect six different water-borne bacterial indicators and pathogens by two separate multiplex PCR protocols. The corresponding primer sets showed significant affinities for their target genes. In order to facilitate PCR product detection, the primer sets were designed so that the expected size of the amplicons from each target gene would be different in gel electrophoresis. In our study, no products were observed from the negative controls and only specific and expected PCR amplicons from the positive controls were obtained, confirming the accuracy, sensitivity and specificity of the protocols. Furthermore, we confirmed the applicability of multiplex PCR not only for spiked water but also for actual water samples. Our findings are generally consistent with results of other studies in which the detection limit of the multiplex PCR for the bacterial targets was estimated at 102 CFU/ml (Kong et al. 2002; Fan et al. 2008). We also believe that it is possible to reduce bacterial detection time in water to less than 16 hours. This can be achieved by enriching the sample to increase the number of bacteria prior to analysis by multiplex PCR.

CONCLUSION

This study confirms the applicability of multiplex PCR for water quality monitoring. In conclusion, our findings showed that the developed multiplex PCR protocols represent a simple and efficient diagnostic for co-detection of water-borne bacteria and have the potential to provide earlier warnings of possible public health threats and more accurate surveillance of these organisms.

ACKNOWLEDGEMENTS

We would like to express our gratitude to Jacqueline Ameri for helpful comments and critical guidance in the revision.

CONFLICT OF INTERESTS

The authors declare that there is no conflict of interests.

REFERENCES

REFERENCES
Abd-El-Haleem
D.
Kheiralla
Z. H.
Zaki
S.
Rushdy
A. A.
Abd-El-Rahiem
W.
2003
Multiplex-PCR and PCR-RFLP assays to monitor water quality against pathogenic bacteria
.
Journal of Environmental Monitoring
5
,
865
870
.
Alhamlan
F. S.
Al-Qahtani
A. A.
Al-Ahdal
M. N.
2015
Recommended advanced techniques for waterborne pathogen detection in developing countries
.
The Journal of Infection in Developing Countries
2
,
128
135
.
APHA/AWWA/WEF
2012
Standard Methods for the Examination of Water and Wastewater
. 22nd edn.
American Public Health Association/American Water Works Association/Water Environment Federation
,
Washington, DC
,
USA
.
Bitton
G.
2014
Microbiology of Drinking Water Production and Distribution
.
Wiley-Blackwell
,
Hoboken, NJ
.
Fan
H.
Wu
Q.
Kou
X.
2008
Co-detection of five species of water-borne bacteria by multiplex PCR
.
Life Science Journal
5
(
4
),
47
54
.
Fey
A.
Eichler
S.
Flavier
S.
Christen
R.
Höfle
M. G.
Guzmán
C. A
.
2004
Establishment of a real-time PCR-based approach for accurate quantification of bacterial RNA targets in water, using Salmonella as a model organism
.
Applied and Environmental Microbiology
70
,
3618
3623
.
Khan
A. S.
Levitt
M. A.
Sage
M. J
.
2000
Biological and Chemical Terrorism: Strategic Plan for Preparedness and Response
.
Recommendations of the CDC Strategic Planning Workgroup. Centers for Disease Control and Prevention, Atlanta, GA
.
Kong
R. Y.
Lee
S. K.
Law
T. W.
Law
S. H.
Wu
R. S.
2002
Rapid detection of six types of bacterial pathogens in marine waters by multiplex PCR
.
Water Research
36
,
2802
2812
.
Kortepeter
M. G.
Parker
G. W.
1999
Potential biological weapons threats
.
Emerging Infectious Diseases
5
(
4
),
523
527
.
Li
L.
Mendis
N.
Trigui
H.
Oliver
J. D.
Faucher
S. P.
2014
The importance of the viable but non-culturable state in human bacterial pathogens
.
Frontiers in Microbiology
5
,
258
.
Luyt
C. D.
Tandlich
R.
Muller
W. J.
Wilhelmi
B. S.
2012
Microbial monitoring of surface water in South Africa: an overview
.
International Journal of Environmental Research and Public Health
9
(
8
),
2669
2693
.
Nicolson
G. L.
2002
Bioterror and biological warfare agents – a brief summary
.
Emergency Response
4
,
61
66
.
Park
S. H.
Hanning
I.
Jarquin
R.
Moore
P.
Donoghue
D. J.
Donoghue
A. M.
Ricke
S. C.
2011
Multiplex PCR assay for the detection and quantification of Campylobacter spp., Escherichia coli O157:H7, and Salmonella serotypes in water samples
.
FEMS Microbiology Letters
316
(
1
),
7
15
.
Ramírez-Castillo
F. Y.
Loera-Muro
A.
Jacques
M.
Garneau
P.
Avelar-González
F. J.
Harel
J.
Guerrero-Barrera
A. L.
2015
Waterborne pathogens: detection methods and challenges
.
Pathogens
4
,
307
334
.
Rundell
M. S.
Pingle
M.
Das
S.
Hussain
A.
Ocheretina
O.
Charles
M.
Barany
F.
2014
A multiplex PCR/LDR assay for simultaneous detection and identification of the NIAID category B bacterial food and waterborne pathogens
.
Diagnostic Microbiology and Infectious Disease
79
(
2
),
135
140
.
Tsen
H. Y.
Jain
L. Z.
Chi
W. R.
1998
Use of a multiplex PCR system for the simultaneous detection of heat labile toxin I and heat stable toxin II genes of enterotoxigenic Escherichia coli in skim milk and porcine stool
.
Journal of Food Protection
61
(
2
),
141
145
.
Wei
B.
Cha
S. Y.
Kang
M.
Park
I. J.
Moon
O. K.
Park
C. K.
Jang
H. K.
2013
Development and application of a multiplex PCR assay for rapid detection of 4 major bacterial pathogens in ducks
.
Poultry Science
92
(
5
),
1164
1170
.
WHO
2014
World Health Organization Water Sanitation and Health
.
Zhao
X.
Lin
C.-W.
Wang
J.
Oh
D. H.
2014
Advances in rapid detection methods for food borne pathogens
.
Journal of Microbiology and Biotechnology
24
(
3
),
297
312
.