The aim of this study was to identify bacteria present in ripened manganese removal filters for drinking water production. The bacterial population was identified with ‘next generation’ DNA sequencing, and specific bacteria were quantified with quantitative polymerase chain reaction (qPCR) and characterized by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) analysis. The ‘next generation’ DNA sequencing analysis showed a bacteria population shift from the iron oxidizing species Gallionella spp. in the Fe-filter to manganese and nitrite oxidizing species Pseudomonas spp. and Nitrospira spp., respectively, present in the manganese removal filter. qPCR analysis confirmed the presence of a low concentration of the well-known Mn2+-oxidizing species Ps. putida in the manganese removal filter backwash water. Bacteria of the genus Pseudomonas, isolated from backwash water from a manganese removal filter were cultured and identified with MALDI-TOF MS analysis. Amongst others, P. gessardii, P. grimontii, and P. koreensis were identified. The presence of several manganese oxidizing bacteria species in ripened filter media supports the assumption that a microbial consortium is involved in the oxidation of manganese. Understanding the mechanisms by which manganese coating of filter media commences could endorse the creation of conditions favouring Birnessite formation, and possibly help in reducing typically long ripening periods of manganese removal filters with virgin filter media.

INTRODUCTION

An important drawback of aeration-rapid sand filtration, commonly applied in several West European countries to remove manganese from groundwater, is the long filter media ripening period.

Farnsworth et al. (2012) reported that manganese oxide formed on the filter media, responsible for manganese removal, is a Birnessite type of mineral. Due to its structure, Birnessite has outstanding properties to adsorb and subsequently oxidize Mn2+ (Post & Veblen 1990; Post 1999). Bruins et al. (2015a) showed that Birnessite present in the coating of a ripened manganese removing filter in operation for over 15 years, was of physicochemical origin. Chemical formation of Birnessite requires alkaline conditions (Feng et al. 2005). The redox potential – pH diagram for aqueous manganese (Stumm & Morgan 1996), suggests that besides a high pH, a high redox potential is required for chemical formation of MnOx. Such water quality characteristics are not common for groundwater with, usually, low pH and low redox potential. Using electron paramagnetic resonance and Raman spectroscopy, Bruins et al. (2015b), showed that formation of Birnessite most likely starts through biological activity. In a number of other studies, it was also proposed that manganese removal is an obligatory biological process (Vandenabeele et al. 1992; Katsoyiannis & Zouboulis 2004; Burger et al. 2008a, 2008b; Tekerlekopoulou et al. 2008; Farnsworth et al. 2012). Several species of bacteria (Pseudomonas spp., Leptothrix spp. and Bacillus spores) able to oxidize or involved in oxidation of Mn2+ have been identified in (ground)water (Tebo et al. 2005; Kim et al. 2011). Pseudomonas spp., in particular Pseudomonas putida, were extensively studied in relation to manganese oxidation (DePalma 1993; Gounot 1994; Caspi et al. 1998; Brouwers et al. 1999; Villalobos et al. 2003, 2006; Tebo et al. 2004, 2005; Barger et al. 2009). Similar studies were performed for Leptothrix spp. (Adams & Ghiorse 1985; Boogerd & de Vrind 1987; Corstjens et al. 1997; Hope & Bott 2004; Tebo et al. 2004, 2005; Burger et al. 2008a, 2008b; Barger et al. 2009; El Gheriany et al. 2009) and Bacillus spp. spores (de Vrind et al. 1986; Mann et al. 1988; Brouwers et al. 2000; Tebo et al. 2004, 2005; Barger et al. 2005, 2009). Experiments with (spores of) Bacillus spp. were, however, often done with species of marine origin (Mann et al. 1988; Webb et al. 2005a, 2005b).

Pseudomonas spp. and Leptothrix spp. are heterotrophic bacteria. Leptothrix spp. are able to oxidize iron as well as manganese, whereas Pseudomonas spp. are known to oxidize manganese only (Daum et al. 1998; Fleming et al. 2011). However, recently a novel autotrophic iron oxidizing Pseudomonas species was found (Su et al. 2015). Despite extensive research, it is still not clear how heterotrophic bacteria benefit from manganese oxidation (Tebo et al. 2005; De Schamphelaire et al. 2007; Geszvain et al. 2013). However, from literature it is known that Mn2+ oxidation to MnO2, by Pseudomonas putida, could be beneficial for the co-metabolic degradation of micropollutants, resulting in the formation of easily accessible organic compounds for their metabolism (Sabirova et al. 2008; Forrez et al. 2010; Meerburg et al. 2012). Similarly, it is proposed that complex organic molecules (e.g., natural organic matter (NOM), such as humic acids in groundwater) undergo degradation by the same process, performed by e.g., Pseudomonas putida (Verstraete 2013). Based on the proposed model of Mn2+ oxidation by e.g., Pseudomonas putida and co-metabolic degradation of organic micro pollutants from Meerburg et al. (2012), a simplified degradation scheme for NOM is adopted (Figure 1). The process of co-metabolic degradation is known as ‘bio cracking’.
Figure 1

Simplified co-metabolic degradation scheme of NOM by biological MnOx oxidation (adopted from Meerburg et al. (2012) and Verstraete (2013)).

Figure 1

Simplified co-metabolic degradation scheme of NOM by biological MnOx oxidation (adopted from Meerburg et al. (2012) and Verstraete (2013)).

From Figure 1 it can be seen that MnOx, formed during the process of bio cracking, is reduced again to Mn2+, in a self-supporting metabolic cycle. Literature suggested that not one bacterium is responsible for manganese oxidation, but a microbial consortia (Vandenabeele et al. 1992; Vandenabeele 1993; Verstraete 2013). Once biological Birnessite (MnOx) is formed on filter media, it has extremely high adsorptive capacity for metal ions, such as Mn2+ (Webb et al. 2005a, 2005b; Jiang et al. 2010). In this way biologically produced Birnessite promotes and accelerates manganese removal through physicochemical autocatalytic adsorption and subsequent oxidation of adsorbed manganese according to the oxidation kinetics of dissolved Mn2+ by oxygen in aqueous solution (Stumm & Morgan 1996).

The goal of this study was to provide additional insight into the role of microbes in manganese removal. A specific objective of the study was to identify (with molecular (DNA) techniques) species of bacteria present in iron removal filters, and freshly ripened manganese removal filters. Furthermore the capability of selected bacterial species found in manganese removal filters to oxidize Mn2+ was investigated in the laboratory. This study will enhance knowledge of the role of biological activity in the ripening of manganese filters in practice and show how to create conditions favorable for the biological manganese oxidation process.

MATERIALS AND METHODS

The experiments presented in this paper were carried out on a pilot plant located at a full scale groundwater treatment plant (GWTP) ‘Grobbendonk’, operated by the water supply company Pidpa, Belgium.

The full scale plant consists of a pre-aeration step (cascade), 1st filtration stage, post aeration (cascade) with pH correction, and post filtration. GWTP Grobbendonk treats groundwater containing iron, manganese and ammonia. Very effective removal of iron (>98%) is achieved in the 1st filtration step. Iron is removed predominantly through adsorptive and biological mechanisms, with support of the bacterium Gallionella sp. Filter media ripening of the post filters in this plant, concerning manganese removal, is a very fast process (typically complete manganese removal is achieved within approximately 16 days). It is believed that the filter media ripening process at this location is initially biological. Similar to post filters in the full scale plant, the pilot filter column was fed with re-aerated filtrate from the first filter stage of the full scale GWTP, after pH correction (pH =7.6). The pilot filter column is named in the rest of the paper as ‘column A1’. Details of GWTP Grobbendonk and the pilot filter column are given in Bruins et al. (2015b).

To determine the presence and composition of the bacteria population, during the filter media ripening process samples were taken from backwash water from the 1st filtration step in the full scale plant Grobbendonk (‘BW 1st RSF’), and backwash water from the pilot filter column A1 (‘BW A1’). Backwash water was used to obtain a higher bacteria yield. ‘BW A1’ was sampled when filter media ripening was almost completed (i.e., manganese removal efficiency in the filter was >90%).

Measurements and subsequent identification of bacteria present in ‘BW 1st RSF’ and ‘BW A1’ were carried out with ‘next generation DNA sequencing’, quantitative polymerase chain reaction (qPCR) and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). Finally, growth tests were performed in a fermenter with selected bacteria from a sample of ‘BW A1’, to examine if MnOx could be produced biologically. In addition a pure culture of Pseudomonas putida (ATCC 23483, LMG 2321), grown on a selective growth medium, was used as a reference.

Next generation DNA sequencing

Samples were taken from both, ‘BW 1st RSF’ and ‘BW A1’. The DNA in the samples was extracted using the power biofilm DNA isolation kit including a beat-beating step for enhanced cell disruption (MoBio Laboratories, Carlsbad, USA). A part of the 16S rRNA gene (approximately 900 bp) was amplified from these samples, using a eubacterial forward primer GM3 (5′-AGA GTT TGA TCM TGG C-3′), and the universal reverse primer 926r (5′-CCG TCA ATT CMT TTG AGT TT-3′) with identifiable sample bar codes. The pyrosequencing analysis of the amplified 16S rRNA genes was performed using LGC genomics (Berlin, Germany) with a 454 Life Sciences GS FLX series genome sequencer upgraded to long read length (Roche, The Netherlands). The returned 16S rRNA gene sequences were analysed, trimmed, aligned, and identified using the metagenomics tool in the software package Bionumercs (Schloss et al. 2011) based on the 454 SOP (Schloss et al. 2011) and the Mothur pipeline software tool (Schloss et al. 2009).

In short, sequences were analysed and sequencing errors were reduced using flowgrams. To reduce computing time the maximum number of flows was set to 650–900 depending on the number of available sequences (50,000–200,000). Subsequently, sequences were trimmed (arbitrary choices: only sequences with minimum lengths of 200 bp and with both primer sequences were selected, tdiffs: 3, and max homop: 8). Sequences were identified against the Silva reference file release 111 (www.arb-silva.de). To display sequence abundance a taxonomic tree was calculated with a minimal percentage of all observations of >1%.

qPCR

For the qPCR measurements employed to determine Leptothrix spp., a Light cycler 480 II from Roche was used. Samples were taken from both ‘BW 1st RSF’ and ‘BW A1’. A sample of 100 mL water was filtered through a 0.45 μm membrane filter. The filter was used in the ‘powerbiofilm DNA extraction kit’ from MoBio (article number: 24000-50). DNA extraction is based on mechanical and chemical lysis. DNA binds to a silica membrane, followed by wash steps. After that, DNA is eluted in 100 μl elution buffer from the MoBio kit. Primers and probe for Leptothrix spp. were heterogeneous for its 16S rRNA. Two upstream primers for Leptothrix spp. are required to get all relevant species.

Forward primer1 PS-1: 5′ ACGGTAGAGGAGCAATC 3′ (Burger et al. 2008a).

Forward primer2 PSP-6: 5′ CAGTAGTGGGGGATAGCC 3′ (Burger et al. 2008a).

Reverse primer DSP-6: 5′ GCTTTTGTCAGGGAAGAAATC 3′ (Burger et al. 2008a).

Lepto-pr6 forward: 5′ CACGCGGCATGGCT 3′ *Cy5 (developed by WLN).

The PCR program was as follows: 10 minutes room temperature (uracil glycosylase), 5 minutes 95 °C (denaturation), 50 × 30 seconds at 95 °C; 1 minute at 55 °C and 10 seconds at 72 °C.

To quantify the number of bacteria, a WLN-III plasmid was developed for target genes. The start concentration of this plasmid is referenced to the mip gene of the standardized Minerva plasmid, and is about 160,000 cDNA/L for Leptothrix spp.

To determine the gene copy numbers of Pseudomonas spp. and Pseudomonas putida, a qPCR protocol, using newly developed primers was used. For the specific detection of Pseudomonas spp. primers were developed targeting the 16S rRNA gene, for detection of P. putida, the more variable gyrB gene was selected. The primers and probe used for detection of Pseudomonas spp. were Pspp16Sf1 (5′-GAG CCT AGG TCG GAT TAG-3′), Psppr3 (5′-CGC TAC ACA GGA AAT TCC AC-3′), and probe PsppP1 (5′-CGC GTG TGT GAA GAA GGT CTT CG-3′). For quantification of P. putida the primers PpgyrBf3 (5′-GAC ATC CTG GCC AAG CGT-3′) and PpgyrBr3 (5′-CTT CCT GYT CGA TGT AGC-3′) and probe PpgyrBp1 (5′-CTG CAR TGG AAY GAC AGC TTC AAC G-3′) were selected. Primer specificity and selectivity were analysed and PCR conditions were optimized.

PCR was conducted in 50 μl reaction volumes containing 25 μl of 2x IQ Supermix (Bio-Rad Laboratories BV, The Netherlands), 10 pmol of the forward primer, reverse primer and probe, 20 mg of bovine serum albumin, and 10 μl of the DNA template. The amplification program consisted of 2 min at 95 °C; 43 cycles of 20 s at 95 °C and 30 sec at 60 °C. Amplification, detection, and data analysis were performed in an iCycler IQ real-time detection system (Bio-Rad Laboratories BV, The Netherlands). The PCR cycle after which the fluorescence signal of the amplified DNA and the probe was detected (threshold cycle [Cq]) was used to quantify the gene copy concentration. Quantification was based on comparison of the sample Cq value with the Cq values of a calibration curve based on known copy numbers of the plasmin containing the 16S rRNA gene of P. putida (U70977.1) and the gyrB gene of P. putida (HF545867.1).

MALDI-TOF MS

With this technique microorganisms can be identified directly after culturing on selective agar media. Spectra were generated with the MALDI-TOF MS biotyper from Brϋker Daltonik GmbH, and compared with approximately 4,000 spectra in the Brϋker Daltonik GmbH database. In a log score from 1 to 3, the MALDI-TOF biotyper defined the similarity of the known and unknown spectra.

When the log score is between 2 and 2.3, the genus identification is secure and probably the species is also identified. With a log score >2.3, it is highly probable that the species is identified.

MALDI-TOF MS is based on the chemotaxonomy of microorganisms. This ‘fingerprint’ is based on identified proteins of the microorganism. These proteins are always present in a living cell and make it possible to characterize microorganisms. In this project we expected Pseudomonas to grow in the filter column where Mn2+ was oxidized (‘BW A1’). Samples were filtered through a 0.45 μm membrane and incubated on Pseudomonas specific agar, a media containing cetrimide and sodium nalidixate to inhibit gram positive bacteria and some gram negatives other than Pseudomonas.

Pseudomonas secretes a variety of pigments, including pyocyanin (blue-green), pyoverdine (yellow-green and fluorescent), and pyorubin (red-brown). Coloured colonies on a Pseudomonas agar are suspected to be Pseudomonas, and they were identified using the MALDI-TOF MS biotyper from Brüker. A single colony of a target organism is put directly on a 96 target plate. After deposition, the spots were overlaid with 1 μl matrix solution (2.5 mg α-Cyano-4-hydroxycinnamic dissolved in 50% acetonitrile, 2.5% trifluoro acetic acid, 47.5% ultra-pure water). The matrix opens the cell wall. A laser irradiates the matrix sample, to divide it into little portions of proteins. The matrix evaporates and positively charged proteins become free. In the strong electric field, the positively charged proteins are lined up. So these proteins have the same starting point, before they accelerate in the flight tube to get to their specific time-of-flight corresponding with their specific mass.

Fermenter growth test with selected bacteria to produce biological MnOx

A Bioflow III fermenter from New Brunswick Scientific was inoculated with pure cultures of Pseudomonas putida (ATCC 23483, LMG 2321), as well as with P. grimontii and P. koreensis, which were isolated from ‘BW A1’. The growth medium used in the fermenter is described by Jiang et al. (2010). Growth and subsequent manganese oxidation in the fermenter took place over 4 days. Growth of the Pseudomonas spp. was achieved by use of the standard Pseudomonas agar growth medium (48.4 g agar and 10 ml glycerol per liter, sterilized for 15 min at 121 °C). The incubation time for growth was 24–48 hr. at 30 °C. Colonies were identified by MALDI-TOF MS and stored in pentone-glycerol at −80 °C. Formation of MnOx was identified as black deposits and was verified by inductively coupled plasma mass spectrometry (ICP-MS) and scanning electron microscopy with energy dispersive X-ray spectroscopy (SEM-EDX).

RESULTS AND DISCUSSION

Next generation DNA sequencing

Table 1 provides an overview of the bacterial population found in backwash water samples from the first stage filter (‘BW 1st RSF’) and the pilot filter column (‘BW A1’). The sequencing results of sample ‘BW 1st RSF’ are based on 188,241 sequences, whereas the results of sample ‘BW A1’ are based on 55,298 sequences. The taxonomic trees are shown in Appendices A and B (Supplementary Information, available with the online version of this paper).

Table 1

Bacterial population in samples of ‘BW 1st RSF’ and ‘BW A1’

SampleIdentification% of population
BW 1st RSF Gallionella spp. 97.0 
Other 3.0 
BW A1 Nitrospira spp. 25.7 
Pseudomonas spp. 14.3 
Gallionella spp. 12.4 
Other 47.6 
SampleIdentification% of population
BW 1st RSF Gallionella spp. 97.0 
Other 3.0 
BW A1 Nitrospira spp. 25.7 
Pseudomonas spp. 14.3 
Gallionella spp. 12.4 
Other 47.6 

Table 1 shows a clear difference in bacterial population present in sample ‘BW 1st RSF’ (iron removal filter of the full scale plant) in comparison to bacteria present in ‘BW A1’ of the freshly ripened (manganese removal) pilot filter column.

The majority (97%) of bacteria found in ‘BW 1st RSF’ were Gallionella spp. The abundance of Gallionella spp. is understandable as iron removal takes place by a biological removal mechanism. Very similar bacterial composition is present in the feed water to the 2nd stage full scale and thus also in the feed water of the pilot filter column. Identification of bacteria present in ‘BW A1’, showed that only 12.4% of the bacterial population was Gallionella spp., Pseudomonas spp. and Nitrospira spp. represented 14.3% and 25.7% of the total population, respectively. Almost half of the population found in ‘BW A1’ belongs to smaller populations or could not be identified. The presence of the bacterium Nitrospira spp. (25.7%) was expected, because this species is involved in the oxidation of ammonia and specifically conversion of nitrite to nitrate, which takes place in this filter. Pseudomonas spp. might be involved in the biological manganese removal process. The literature suggests that besides oxidation of manganese, Pseudomonas spp. are able to oxidize ammonia (Daum et al. 1998; Nemergut & Schmidt 2002). This finding also explains the strong relation between manganese and ammonia oxidation observed in practice (Bruins et al. 2014). The observation that 14.3% of the bacterial population found in ‘BW A1’ consists of Pseudomonas spp., a potential manganese oxidizing bacterium, supports the assumption that manganese removal starts biologically (Bruins et al. 2015b).

qPCR

Leptothrix spp. and Pseudomonas spp., are both able to oxidize dissolved manganese. Their concentration was quantified with qPCR as the number of DNA copies (n [cDNA/L]) present in ‘BW A1’. Furthermore the concentration of the species Pseudomons putida was quantified with the same technique. Table 2 gives an overview of the number of quantified species, expressed as DNA copies/L.

Table 2

Manganese oxidizing bacteria in sample ‘BW A1’, quantified by qPCR

Bacteriumn (cDNA/L)%
Pseudomonas spp. 2.3 × 1011 >99.99% 
Pseudomonas putida 1.5 × 107 <0.01% 
Leptothrix spp. 3.8 × 106 <0.01% 
Bacteriumn (cDNA/L)%
Pseudomonas spp. 2.3 × 1011 >99.99% 
Pseudomonas putida 1.5 × 107 <0.01% 
Leptothrix spp. 3.8 × 106 <0.01% 

From Table 2 it is clear that from the potential manganese oxidizers the presence of Pseudomonas spp. was much more pronounced than the presence of Leptothrix spp. This supports the fact that Leptothrix spp. were not found with the next generation DNA sequencing. Also Pseudomonas putida was present in relatively low concentrations, compared to the genus Pseudomonas. In literature Pseudomonas putida is often associated with biological manganese removal. However, the species Pseudomonas putida was not ubiquitous and thus not likely responsible for the fast ripening of manganese removal filters in the pilot testing performed in this study. At the same time it is plausible that other closely related Pseudomonas species contributed to this process.

MALDI-TOF MS

Several colonies isolated from sample ‘BW A1’, were cultured with a Pseudomonas agar and were identified by using the MALDI-TOF MS biotyper. Table 3 shows an overview of all identified Pseudomonas species present in the backwash water of a freshly ripened manganese removal filter.

Table 3

Pseudomonas species identified by MALDI-TOF MS (including Log score)

Identified speciesLog score
Pseudomonas gessardii 2.40 
Pseudomonas libanensis 2.22 
Pseudomonas synxantha 2.21 
Pseudomonas veronii 2.17 
Pseudomonas grimontii (Figure 22.15 
Pseudomonas koreensis (Figure 22.14 
Pseudomonas extremorientalis 2.07 
Pseudomonas marginalis 2.04 
Pseudomonas tolaasii 2.03 
Pseudomonas azotoformans 2.03 
Pseudomonas rhodesiae 2.00 
Identified speciesLog score
Pseudomonas gessardii 2.40 
Pseudomonas libanensis 2.22 
Pseudomonas synxantha 2.21 
Pseudomonas veronii 2.17 
Pseudomonas grimontii (Figure 22.15 
Pseudomonas koreensis (Figure 22.14 
Pseudomonas extremorientalis 2.07 
Pseudomonas marginalis 2.04 
Pseudomonas tolaasii 2.03 
Pseudomonas azotoformans 2.03 
Pseudomonas rhodesiae 2.00 

The genus Pseudomonas consists of many very closely related species. No Pseudomonas putida was identified in any of the samples with MALDI-TOF MS. This was expected based on the low contribution of the strain P. putida to the total bacterial population determined with qPCR (<0.01%). The list of Pseudomonas species (Table 3) is incomplete, as only a limited number of colonies are identified. SEM images (Figure 2) show two Pseudomonas species, namely Pseudomonas grimontii and Pseudomonas koreensis in the backwash water of a freshly ripened manganese removal filter.
Figure 2

SEM images (10,000×) of Pseudomonas grimontii (L) and Pseudomonas koreensis (R), isolated from sample ‘BW A1’.

Figure 2

SEM images (10,000×) of Pseudomonas grimontii (L) and Pseudomonas koreensis (R), isolated from sample ‘BW A1’.

Fermenter growth test with selected bacteria for the biological production of MnOx

Pseudomonas grimontii (log: 2.15) and Pseudomonas koreensis (log: 2.14), obtained from ‘BW A1’, were used as inoculum in a fermenter to investigate their growth and MnOx production under controlled laboratory conditions. As a reference, a similar growth test was conducted with the laboratory species Pseudomonas putida (ATCC 23483, LMG 2321). Although to a very limited extent, Pseudomonas putida was able to produce MnOx. Results obtained from the fermenter growth test showed that Pseudomonas grimontii and Pseudomonas koreensis were not able to oxidize Mn2+ producing MnOx, under the laboratory conditions.

Summarizing, results from this study show that the population of bacteria present in the backwash water of the 1st stage (iron removal) filter and the freshly ripened 2nd stage (manganese removal) pilot filter column dramatically changed. Furthermore the presence of Pseudomonas putida was very limited (<0.01% of the potential manganese oxidizing bacteria present). This indicates that the role of Pseudomonas putida, concerning manganese removal at the Grobbendonk treatment plant, is limited. However, related Pseudomonas species, may play an important role in the process of manganese removal (Table 3), taking into account that the Birnessite (MnOx) produced in the pilot filter column during the ripening period was of biological origin (Bruins et al. 2015b). It remains, however, unclear if Pseudomonas spp. are the only manganese oxidizing bacteria involved in the initial Mn2+ oxidation, or if other species form a microbial consortium, together responsible for the oxidation of Mn2+. The knowledge that manganese removal in aeration-rapid sand filtration treatment is initiated biologically, together with an insight into the manganese oxidizing bacteria species involved, may enable typically long ripening times to be reduced by creating conditions favorable for the growth of these manganese oxidizing species. Therefore, the focus of the follow-up research will be on the inoculation of a consortium of bacteria, identified in manganese removing filters, to enhance filter media ripening. Also, conditions supporting the fast growth of Mn2+ oxidizing bacteria should be investigated in follow-up research.

CONCLUSIONS

From this study the following can be concluded:

  • Based on ‘next generation DNA sequencing’ analyses, the population of bacteria present in backwash water from an iron removal filter (first step filter in a full scale plant), and the freshly ripened pilot manganese removal filter showed a clear population shift from the iron oxidizing Gallionella spp. (97%) to manganese and nitrite oxidizing species (Pseudomonas spp. (14%) and Nitrospira spp. (26%), respectively). However, it should be noted that 47.6% of the bacterial population in the manganese removal filter belongs to smaller populations or could not be identified.

  • qPCR analysis showed that less than 0.01% of the genus Pseudomonas present in the freshly ripened manganese removal pilot filter column was the Pseudomonas putida species.

  • Pseudomonas is most likely one of the manganese oxidizing bacteria genera that play an important role in the initial stage of the ripening of the manganese removal filters at the full scale GWTP Grobbendonk. However, it is still unclear whether this genus of bacteria is acting alone or as part of a microbial consortium.

  • Amongst others, P. gessardii, P. grimontii and P. koreensis, closely related Pseudomonas species, were detected by the MALDI-TOF MS analysis, and are probably involved in the manganese removal process, possibly as part of a bacterial consortium.

  • Selected Pseudomonas species from the ripened filter media column, namely Pseudomonas grimontii and Pseudomonas koreensis, were not able to produce MnOx under controlled laboratory conditions, whereas the reference species Pseudomonas putida was able to do so.

ACKNOWLEDGEMENTS

This research was financially and technically supported by WLN and the Dutch water companies Groningen (WBG) and Drenthe (WMD). The authors are grateful to Mrs Marsha van der Wiel and Mr Pim Willemse of WLN for providing qPCR, MALDI-TOF MS analysis and performing the growth tests, and to Mr Jelmer Dijkstra of Wetsus for performing SEM-analysis. Thanks also to water company Pidpa (Belgium), for their willingness to share the data from their groundwater treatment plant and providing the opportunity to perform a pilot test at Grobbendonk.

REFERENCES

REFERENCES
Adams
L. F.
Ghiorse
W. C.
1985
Influence of manganese on growth of a sheathless strain of Leptothrix discophora
.
Applied and Environmental Microbiology
49
(
3
),
556
562
.
Barger
J. R.
Tebo
B. M.
Bergmann
U.
Webb
S. M.
Glatzel
P.
Chiu
V. Q.
Villalobos
M.
2005
Biotic and abiotic products of Mn(II) oxidation by spores of the marine Bacillus sp. strain SG-1
.
American Mineralogist
90
,
143
154
.
Barger
J. R.
Fuller
C. C.
Marcu
M. A.
Brearly
A.
Perez De la Rosa
M.
Webb
S. M.
Caldwell
W. A.
2009
Structural characterization of terrestrial microbial Mn oxides from Pinal Creek, AZ
.
Ceochimica et Cosmochimica Acta
73
,
889
910
.
Boogerd
F. C.
de Vrind
J. P. M.
1987
Manganese oxidation by Leptothrix discophora
.
Journal of Bacteriology
169
(
2
),
489
494
.
Brouwers
G. J.
de Vrind
J. P. M.
Corstjens
P. L. A. M.
Cornelis
P.
Baysse
C.
Vrind de Jong
E. W.
1999
cumA, a gene encoding a multicopper oxidase, is involved in Mn2+oxidation in Pseudomonas putida GB-1
.
Applied and Environmental Microbiology
65
(
4
),
1762
1768
.
Brouwers
G. J.
Vijgenboom
E.
Corstjens
P. L. A. M.
de Vrind
J. P. M.
de Vrind-de Jong
E. W.
2000
Bacterial Mn2+ oxidizing systems and multicopper oxidases: an overview of Mechanisms and Functions
.
Geomicrobiology Journal
17
(
1
),
1
24
.
Bruins
J. H.
Vries
D.
Petrusevski
B.
Slokar
Y. M.
Kennedy
M. D.
2014
Assessment of manganese removal from over 100 groundwater treatment plants
.
Journal of Water Supply: Research and Technology-AQUA
63
(
4
),
268
280
.
Bruins
J. H.
Petrusevski
B.
Slokar
Y. M.
Kruithof
J. C.
Kennedy
M. D.
2015a
Manganese removal from groundwater: characterization of filter media coating
.
Desalination & Water Treatment
55
(
7
),
1851
1863
.
Bruins
J. H.
Petrusevski
B.
Slokar
Y. M.
Huysman
K.
Joris
K.
Kriuithof
J. C.
Kennedy
M. D.
2015b
Biological and physicochemical formation of Birnessite during the ripening of manganese removal filters
.
Water Research
69
,
154
161
.
Burger
M. S.
Krentz
C. A.
Mercer
S. S.
Gagnon
G. A.
2008a
Manganese removal and occurrence of manganese oxidizing bacteria in full-scale biofilters
.
Journal of Water Supply: Research and Technology-AQUA
57
(
5
),
351
359
.
Burger
M. S.
Mercer
S. S.
Shupe
G. D.
Gagnon
G. A.
2008b
Manganese removal during bench-scale biofiltration
.
Water Research
42
,
4733
4742
.
Caspi
R.
Tebo
B. M.
Haygood
M. G.
1998
C-Type cytochromes and manganese oxidation in Pseudomonas putida MnB1
.
Applied and Environmental Microbiology
64
(
10
),
3549
3555
.
DePalma
S. R.
1993
Manganese Oxidation by Pseudomonas putida. PhD Thesis
,
Harvard University
,
Cambridge
,
USA
.
De Schamphelaire
L.
Rabaey
K.
Boon
N.
Verstraete
W.
Boeckx
P.
2007
Minireview: the potential of enhanced manganese redox cycling for sediment oxidation
.
Geomicrobiology Journal
24
(
7
),
547
558
.
de Vrind
J. P. M.
Boogerd
F. C.
de Vrind de–Jong
E. W.
1986
Manganese reduction by a marine Bacillus species
.
Journal of Bacteriology
167
(
1
),
30
34
.
El Gheriany
I. A.
Bocioaga
B.
Anthony Hay
A. D.
Ghiorse
W. C.
Shuler
M. L.
Lion
L. W.
2009
Iron requirement for Mn(II) oxidation by Leptothrix discophora SS-1
.
Applied and Environmental Microbiology
75
(
5
),
1229
1235
.
Farnsworth
C. E.
Voegelin
A.
Hering
J. G.
2012
Manganese oxidation induced by water table fluctuations in a sand column
.
Environ. Sci. Technol.
46
,
277
284
.
Feng
A.
Tan
W.
Liu
F.
Huang
Q.
Liu
X.
2005
Pathways of Birnessite formation in alkali medium
.
Sci. China Ser. D.
48
(
9
),
1438
1451
.
Fleming
E. J.
Langdon
A. E.
Martinez-Garcia
M.
Stepanauskas
R.
Poulton, N. J., Masland
E. D. P.
Emerson
D.
2011
What's new is old: resolving the identity of Leptothrix ochracea using single cell genomics, pyrosequencing and FISH
.
PLoS ONE
6
(
3
),
1
10
.
Forrez
I.
Carballa
M.
Verbeken
K.
Vanhaecke
L.
Schlüsener
M.
Ternes
T.
Boon
N.
Verstrete
W.
2010
Diclofenac oxidation by biogenic manganese oxides
.
Environmental Science & Technology
44
(
9
),
3449
3454
.
Katsoyiannis
I.A.
Zouboulis
A.I.
2004
Biological treatment of Mn(II) and Fe(II) containing groundwater: kinetic considerations and product characterization
.
Water Research
38
,
1922
1932
.
Kim
S. S.
Bargar
J. R.
Nealson
K. H.
Flood
B. E.
Kirschvink
J. L.
Raub
T. D.
Tebo
B. M.
Villalobos
M.
2011
Searching for biosignatures using Electron Paramagnetic Resonance (EPR) analysis of manganese oxides
.
Astrobiology
11
(
8
),
775
786
.
Mann
S.
Sparks
N. H. C.
Scoot
G. H. E.
Vrind-De Jong
E. W.
1988
Oxidation of manganese and formation of Mn3O4 (Hausmannite) by spore coats of a marine Bacillus sp
.
Applied and Environmental Microbiology
54
(
8
),
2140
2143
.
Meerburg
F.
Hennebel
T.
Vanhaecke
L.
Verstraete
W.
Boon
N.
2012
Diclofenac and 2-anilinophenylacetate degradation by combined activity of biogenic manganese oxides in silver
.
Microbial Technology
5
(
3
),
388
398
.
Nemergut
D. R.
Schmidt
S. K.
2002
Disruption of narH, narJ and moaE inhibits heterotrophic nitrification in Pseudomonas strain M19
.
Applied and Environmental Biology
68
(
12
),
6462
6465
.
Post
J. E.
1999
Manganese oxide minerals: crystal structures and economic and environmental significance
.
Proceedings of the National Academy of Sciences USA
96
,
3447
3454
.
Post
J. E.
Veblen
D. R.
1990
Crystal structure determinations of synthetic sodium, magnesium, and potassium birnessite using TEM and the Rietveld method
.
American Mineralogist
75
,
477
489
.
Sabirova
J. S.
Cloetens
L. F. F.
Vanhaecke
L.
Forrez
I.
Verstraete
W.
Boon
N.
2008
Manganese-oxidizing bacteria mediate the degradation of 17α-ethinylestradiol
.
Microbial Biotechnology
1
(
6
),
507
512
.
Schloss
P. D.
Westcott
S. L.
Ryabin
T.
Hall
J. R.
Hartmann
M.
Hollister
E. B.
Lesniewski
R. A.
Oakly
B. B.
Parks
D. H.
Robinson
C. J.
Sahl
J. W.
Stres
B.
Thallinger
G. G.
Van Horn
D. J.
Weber
C. J.
2009
Introducing Mothur: open source, platform-independent, community-supported software for describing and comparing microbial communities
.
Appl. Environ. Microbiol.
75
(
23
),
7537
7541
.
Schloss
P. D.
Gevers
D.
Westcott
S. L.
2011
Reducing the effects of PCR amplification and sequencing artifacts on 16S rRNA-based studies
.
PLoS ONE
6
(
12
),
e27310
.
doi:10.1371/journal.pone.0027310.
Stumm
W.
Morgan
J. J.
1996
Aquatic Chemistry, Chemical Equilibria and Rates
, 3rd edn.
Wiley
,
New York
.
Su
J. F.
Shao
S. C.
Huang
T. L.
Ma
F.
Yang
S. F.
Zhou
Z. M.
Zheng
S. C.
2015
Anaerobic nitrate-dependent iron(II) oxidation by a novel autotrophic bacterium, Pseudomonas sp. SZF15
.
Journal of Environmental Chemical Engineering
3
,
2187
2193
.
Tebo
B. M.
Marger
J. R.
Clement
B. G.
Dick
G. J.
Murray
K. J.
Parker
D.
Verity
R.
Webb
S. M.
2004
Biogenic manganese oxides: properties and mechanisms of formation
.
Annu. Rev. Earth Planet Sci.
32
,
287
328
.
Tebo
B. M.
Johnson
H. A.
McCarthy
J. K.
Templeton
A. S.
2005
Geomicrobiology of manganese(II) oxidation
.
Trends in Microbiology
13
(
9
),
421
428
.
Tekerlekopoulou
A. G.
Vasiliadou
I. A.
Vayenas
D. V.
2008
Biological manganese removal from potable water using trickling filters
.
Biochemical Engineering Journal
38
,
292
301
.
Vandenabeele
J.
1993
Manganese Removal by Microbial Consortia from Rapid Sand Filters Treating Water Containing Mn2+ and NH4+
.
PhD Thesis
,
Ghent
,
Belgium
.
Vandenabeele
J.
de Beer
D.
Germonpré
R.
Verstreate
W.
1992
Manganese oxidation by microbial consortia from sand filters
.
Microbial Ecology
24
,
91
108
.
Verstraete
W.
2013
Personal Communication, Laboratory of Microbial Ecology and Technology, Department of Biochemical and Microbial Technology
.
Ghent University
,
Belgium
.
Villalobos
M.
Toner
B.
Bargar
J.
Sposito
G.
2003
Characterization of the manganese oxide produced by Pseudomonas putida strain MnB1
.
Geochimica et Cosmochimica Acta
67
(
14
),
2649
2662
.
Villalobos
M.
Lanson
B.
Manceau
A.
Toner
B.
Sposito
G.
2006
Structural model for the biogenic Mn oxide produced by Pseudomonas putida
.
American Mineralogist
91
,
489
502
.
Webb
S. M.
Dick
G. J.
Bargar
J. R.
Tebo
B. M.
2005b
Evidence for the presence of Mn(III) intermediates in the bacterial oxidation of Mn(II)
.
Proceedings of National Academic Science
102
(
15
),
5558
5563
.

Supplementary data