We investigated the interaction of As(III) with As(III)-binding DNA aptamers (Ars-3). The binding of Ars-3 to As(III) was investigated using an Ars-3 sequence and a few control DNA sequences. As a result, we conclude that Ars-3 cannot bind As(III) and As(III) can adsorb onto gold nanoparticles with selectivity. However, the As(III) concentration could be determined by a simple As(III) analysis method using Ars-3, and we measured the As(III) and As(V) concentrations separately in As(III)/As(V) mixed samples in ultrapure water and groundwater using a simple analytical method for As(III) and As(V), respectively. As(III) in the sample was measured by a simple As(III) analytical method using DNA aptamers and gold nanoparticles, and As(V) in the sample was measured by a simple As(V) analysis method using cerium oxide nanoparticles and fluorescence-labeled DNA. We can measure As(III) and As(V) concentrations in ultrapure water and groundwater in the simple analytical method for As(III) and As(V), separately.

  • We investigated the interaction between Ars-3 and As(III).

  • We determined As(III) and As(V) concentrations by simple analytical method for As(III) and As(V).

  • We hypothesized that the simple As(III) analysis method can quantify As(III) concentration by the adsorption of As(III) and ssDNA onto AuNPs.

  • We could determine the As(III) concentration and As(V) concentration in As(III)/As(V) mixed samples for each chemical species.

Graphical Abstract

Graphical Abstract
Graphical Abstract

Inorganic arsenic (As) is one of the ubiquitous elements, and shows physicochemical properties similar to phosphate (Sun et al. 2017). It poses a serious threat including cardiovascular and respiratory diseases, and cancers of skin, lung, liver and kidney (Chung et al. 2013; Flora 2015; Singh et al. 2015). Because of the high toxicity of As, the World Health Organization (WHO) and the US Environmental Protection Agency (USEPA) have set the primary maximum contaminant level (MCL) for total As in drinking water as low as 10 μg/L (WHO 2011; USEPA 2018).

The common commercial instruments for As determination are atomic absorption spectrometry (AAS), atomic fluorescence spectrometry and inductively coupled plasma mass spectrometry (ICP-MS), hydride generation atomic absorption spectrometry (HG-AAS), electrothermal atomic absorption spectrometry (ETAAS), flow injection–hydride generation–inductively coupled plasma mass spectrometry (FI-HG-ICPMS), anodic stripping voltammetry (ASV), and cathodic stripping voltammetry (CSV) using a hanging drop mercury electrode (Das & Sarkar 2016). Although these conventional techniques have excellent determination accuracy and sensitivity, they require sophisticated, expensive and bulky equipment and specialized expertise for operation, and have high operating costs. In addition, these methods cannot determine As(III) and As(V) separately. Hence, they are not suitable for on-site analysis (Kaur et al. 2015).

Inorganic As has two common oxidation states: arsenite (As(III)) and arsenate (As(V)). As(III) has been identified as one of the most harmful ions in water to human health, and it is 60–100 times more toxic than As(V) (Zhan et al. 2014). On the other hand, As(V) is also a harmful ion and distributes more widely than As(III) (Amini et al. 2008). The methods to individually determine As species are HPLC-ICP-MS, gas chromatography, hydride generation–atomic absorption spectrometry, capillary electrophoresis, HG-AAS with KI and X-ray spectroscopic methods such as EXAFS and XANES (Alauddin et al. 2003; Rasmussen et al. 2012; Ardini et al. 2020). For the determination of inorganic As species in natural waters, where the concentration of As is usually found at trace levels, preliminary species separation and preconcentration is required before detection by sensitive analytical techniques (Liang & Liu 2007). It is hard to detect the concentration of As species in aquifers due to the instability of As species which can be changed by environmental factors (e.g., the redox condition, pH value, background ions, organic matter, and microbial activity) (Tao et al. 2022). It is also hard to evaluate the As species in preservative groundwater samples because the transformation between As species is complicated in the environment (Tao et al. 2022). The determination methods of inorganic As species require sample transportation to a laboratory and take a long time for determination. Considering that As speciation changes during sample transportation, it may be obvious that sample transportation to a laboratory risks changing As speciation in the samples. Therefore, more accurate assessment of As speciation in groundwater requires rapid determination after collection of groundwater samples.

Most chemical and biological sensors (including DNA aptasensor) have been developed for determination of AS(III) (Matsunaga et al. 2019). Recently, Zong et al. proved the non-specific binding of the As(III) aptamer (Ars-3) (Kim et al. 2009; Zong & Liu 2019). Since we have not confirmed whether the Ars-3-based aptasensor worked in our previous work (Matsunaga et al. 2019), the principle of the Ars-3-based aptasensor should be confirmed using Ars-3 and other DNA sequences.

Simultaneous determination of As(III) and As(V) is a prerequisite. A sensor for As(V) was developed (Lopez et al. 2017), but the assay has not been applied to environmental samples with both As(III) and As(V). There have been a few reports of the development of simple As(V) analytical methods. However, there has been no report on a combined application of the simple As(III) and As(V) analysis methods described above to samples with As(III) and As(V). The As concentration in groundwater would be accurately evaluated without pretreatment of separation of individual As species by combining the simple analytical method for As(III) and As(V) to determine As(III) and As(V) concentrations in groundwater for each chemical species.

In this study, the interaction between Ars-3 and As(III) in a simple As(III) analysis method was investigated using Ars-3 and other ssDNA sequences. In addition, we attempted to determine As(III) and As(V) concentrations in groundwater including As(III) and As(V) by a combined use of the simple analytical method for As(III) and As(V).

Reagents and instruments

All of the DNA sequences were synthesized by Eurofins Genomics KK (Tokyo, Japan) or Integrated DNA Technologies (Coralville, USA). Table 1 shows the list of the DNA sequences used in this study. AuNPs (core size: 10 nm) in phosphate buffer solution (catalogue number 752584), CeO2NPs (core size: <25 nm) as 10 wt% in H2O (catalogue number 643009-100 ML) and As(III) (NaAsO2, catalogue number S7400-100G) were purchased from Sigma-Aldrich Japan (Tokyo, Japan). MOPS (3-(N-morpholino) propanesulfonic acid) was purchased from Dojindo Laboratories Co., Ltd (Kumamoto, Japan). HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) was purchased from Nacalai Tesque, Inc. (Kyoto, Japan). The Ars-3 was dissolved in a 10 mM MOPS buffer solution of pH 7.3. CeO2NPs were washed by centrifugation and dissolved in the 10 mM HEPES buffer solution of pH 7.6. A solution of 120 mM NaCl and As(V) as a 60% arsenic acid solution (H3AsO4, catalog number 013-04675) were purchased from Fujifilm Wako Pure Chemical Corporation (Osaka, Japan). All solutions were prepared with Milli-Q Water (Merck Millipore, Tokyo, Japan). The absorption spectra were measured by using a spectrophotometer V-630 (JASCO Corporation, Tokyo, Japan). The fluorescence intensity was measured by using a fluorescence spectrophotometer FP-6600 (JASCO Corporation, Tokyo, Japan).

Table 1

The DNA sequences used in this study

DNASequences
Ars-3 5′-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATTTTACAGAACAACCAACGTCGCTCCGGGTACTTCTTCATCGAGATAGTAAGTGCAATCT-3′ 
c-Ars-3 5′-AGATTGCACTTACTATCTCGATGAAGAAGTACCCGGAGCGACGTTGGTTGTTCTGTAAAATTGAATAAGCTGGTATCTCCCTATAGTGAGTCGTATTACC-3′ 
FAM-C6a 5′-[FAM]-CCCCCC-3′ 
DNA-1 5′-GGTTACCTTGAAGCAACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCGATTCTCCTAGACAC-3′ 
DNA-2 5′-AAGCCTGTATACGCGAATCGNNNNNNNNNNNNNNNNNNNNNNNNNTTACGGTCACGGTCAAGTTC-3′ 
DNASequences
Ars-3 5′-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATTTTACAGAACAACCAACGTCGCTCCGGGTACTTCTTCATCGAGATAGTAAGTGCAATCT-3′ 
c-Ars-3 5′-AGATTGCACTTACTATCTCGATGAAGAAGTACCCGGAGCGACGTTGGTTGTTCTGTAAAATTGAATAAGCTGGTATCTCCCTATAGTGAGTCGTATTACC-3′ 
FAM-C6a 5′-[FAM]-CCCCCC-3′ 
DNA-1 5′-GGTTACCTTGAAGCAACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCGATTCTCCTAGACAC-3′ 
DNA-2 5′-AAGCCTGTATACGCGAATCGNNNNNNNNNNNNNNNNNNNNNNNNNTTACGGTCACGGTCAAGTTC-3′ 

aFAM, fluorescein.

Principle of our simple analytical method for As(III)

In this study, we performed the simple analytical method to determine As(III) using an aptamer specific to As(III) (Ars-3) and gold nanoparticles (AuNPs) as described in our previous work (Matsunaga et al. 2019). Briefly, in the absence of As(III), Ars-3 is adsorbed onto the AuNPs surface through a DNA base–gold interaction. The AuNPs that are covered with a negatively charged Ars-3 remain dispersed in the solution even at a high NaCl concentration. In contrast, some Ars-3 forms an aptamer–As(III) complex in the presence of As(III). AuNPs in the solution are no longer covered with Ars-3 and subjected to NaCl-induced aggregation. The aggregation of AuNPs leads to a color change of AuNPs from red to blue. Therefore, a quantitative analysis of the As(III) concentration is possible by measuring the ratio of absorbance that corresponds to the red (529 nm) and blue (615 nm) colors (A615/A529).

Principle of the simple analytical method for As(V)

We performed a simple analytical method to determine As(V) using fluorescein (FAM)-labeled DNA and cerium oxide nanoparticles (CeO2NPs) as described in previous studies (Lopez et al. 2017; Matsunaga et al. 2022). Briefly, FAM-labeled DNA is adsorbed onto the CeO2NP surface and the fluorescence might be quenched. In the absence of As(V), FAM-labeled DNA-CeO2NPs complex remains in the solution. In contrast, As(V) displaces the adsorbed FAM-labeled DNA from the CeO2NPs, resulting in recovery of the fluorescence signal. Therefore, a quantitative analysis of the As(V) concentration is possible by measuring the fluorescence intensity derived from FAM (Ex: 495 nm, Em: 520 nm).

Determination of As(III) and As(V) using the simple analytical methods

The simple analytical method for As(III) used in this study was based on our previous work (Matsunaga et al. 2019). Briefly, a probe solution was prepared by adding 5 μL of Ars-3 solution (final concentration = 10 nM) to 32 μL of the 10 mM MOPS buffer solution in a microtube. A 20 μL sample solution was mixed with the probe solution. After incubation of the mixture for 15 min at room temperature to stabilize the reaction between the probe solution and the sample solution, 40 μL of the AuNPs solution was added to the mixture and incubated for 40 min at room temperature to stabilize the reaction between free Ars-3 and AuNPs. Finally, 3 μL of the NaCl stock solution (4 M) was added to the mixture and incubated for 10 min. The absorption spectrum of a test solution was measured. In our previous work, AuNPs aggregated at NaCl final concentration = 60 mM and As(III) = 10 μM (Matsunaga et al. 2019). However, no aggregation occurred under the conditions described above in this study (Figure S1). Therefore, we determined the NaCl final concentration = 120 mM.

The simple analytical method for As(V) was based on our previous work (Matsunaga et al. 2022). Briefly, the probe solution was prepared by adding CeO2NPs dispersion (final concentration = 15 μg/mL) and FAM-labeled C6 solution (final concentration = 400 nM) to the 10 mM HEPES buffer solution (pH: 7.6). The total volume of the probe solution was 20 μL. After 15 minutes, a 20 μL sample solution was mixed with the probe solution in the microtube. After incubation of the mixture at room temperature for 20 min to equilibrate the adsorption of As(V) and desorption of FAM-labeled C6 on the surface of the CeO2NPs, the fluorescence intensity at 518 nm in the test solution was measured.

We created the calibration curves using As(III) and As(V) (0–50 μM) standard solutions. Each limit of detection (LOD) value was estimated using an equation, 3σ/s, where σ is the standard deviation of ten blank samples and s is the slope of the regression line.

We prepared the As(III)/As(V) samples by adding different concentration ratios of As(III) to As(V) to ultrapure water and groundwater. Groundwater samples were taken in Hokkaido University campus in January 2022. For measurements of the concentration of As(III) and As(V) in groundwater, the samples were filtered through a 0.2 μm pore-size membrane (Advantec Co., Ltd, Japan) and then passed through a cation-exchange column, MetaSEP IC-ME for As(III) analysis (GL Sciences, Tokyo, Japan) or MetaSEP IC-MC for As(V) analysis (GL Sciences, Tokyo, Japan)), as described in the previous studies (Matsunaga et al. 2019; Matsunaga et al. 2022).

The interaction between As(III) and Ars-3

Zong & Liu (2019) elucidated that Ars-3 does not bind to As(III) but interacts with AuNPs and As(III). In this study, we confirmed the interaction between As(III), ssDNA, and AuNPs using Ars-3 and other ssDNA sequences (Figure 1). The A615/A529 of AuNPs was higher than 1.2, indicating that AuNPs aggregated regardless of presence or absence of As(III). The A615/A529 of the Ars-3 sample increased with increasing As(III) concentration, indicating that the Ars-3 inhibited AuNPs aggregation. When c-Ars-3, DNA-1, or DNA-2 was added to the AuNPs solution instead of Ars-3, the A615/A529 also increased with increasing As(III) concentration. This result indicated that c-Ars-3, DNA-1, and DNA-2 could also serve as As(III) probes in our simple As(III) analytical method.
Figure 1

Effect of the sequences of ssDNA of probe solution using the simple analytical method for As(III).

Figure 1

Effect of the sequences of ssDNA of probe solution using the simple analytical method for As(III).

Close modal

Zong & Liu (2019) reported that Ars-3 did not bind to As(III) but ssDNA and As(III) could adsorb onto AuNPs. We suggest that the principle of our simple As(III) analytical method for As(III) is the adsorption of ssDNA and As(III) onto AuNPs. However, we also suggest that the simple analytical methods for As(III) using Ars-3 and AuNPs in previous studies (Zhan et al. 2014; Matsunaga et al. 2019) could work as sensors for As(III) because AuNPs have specificity for As(III) and no metal ions other than As(III) adsorb on AuNPs, as shown in other previous studies (Zhan et al. 2014; Matsunaga et al. 2019; Zong & Liu 2019). In the future, it will be necessary to confirm the mechanism of our simple As(III) analytical method.

Calibration curve of the simple analytical method for As(III) and As(V)

Figure 2 shows the calibration curve for As(III) for the method in this study. The A615/A529 of the test solution without As(III) was 0.46. The A615/A529 increased linearly from 0.46 to 1.3 with increasing As(III) concentration from 0.1 to 50 μM. The LOD was calculated to be 2.5 μM.
Figure 2

Method calibration curve of the simple analytical method for As(III). The dotted line is a regression line.

Figure 2

Method calibration curve of the simple analytical method for As(III). The dotted line is a regression line.

Close modal
Figure 3 shows the calibration curve of the simple analytical method for As(V) in this study. The ΔF of the test solutions increased linearly from 19 to 227 with increasing As(V) concentration from 0.01 to 50 μM. The LOD in this study was calculated to be 4.9 μM.
Figure 3

Method calibration curve of the simple analytical method for As(V). The dotted line is a regression line.

Figure 3

Method calibration curve of the simple analytical method for As(V). The dotted line is a regression line.

Close modal

Determination of As(III) and As(V) concentrations in ultrapure water samples by our methods for As(III) and As(V)

We determined the As(III) concentration and the As(V) concentration in ultrapure water samples, to which As(III) and As(V) were spiked, by our simple As(III) and As(V) analytical methods (Figure 4 and Table S1). The As(III) concentration determined by our method overestimated the As(III)-spiked concentration (recovery rates were between 122% and 134%). The As(V) concentrations determined by our method in ultrapure water (except 5 μM of As(V)) were almost identical to the standard As(V) concentration, and the recovery rate was between 105% and 122%. At 5 μM As(III), the determination of As(V) concentration by our method overestimated the As(V)-spiked concentration by +66%. However, the RSD of As(V) concentration measured by our simple analytical method for As(V) showed 14%–54%.
Figure 4

Relationship between the concentrations of As(III) and As(V) in ultrapure water and those determined by using our method for determination of As(III) and As(V). The total concentration of As in each sample solution is 50 μM. The square dots show As(III) concentration and the circular dots show As(V) concentration.

Figure 4

Relationship between the concentrations of As(III) and As(V) in ultrapure water and those determined by using our method for determination of As(III) and As(V). The total concentration of As in each sample solution is 50 μM. The square dots show As(III) concentration and the circular dots show As(V) concentration.

Close modal

Determination of As(III) and As(V) concentration in groundwater samples by our methods for As(III) and As(V)

We also determined the As(III) concentration and As(V) concentration in groundwater including As(III) and As(V) using our methods for As(III) and As(V) (Figure 5 and Table S2). The determined As(III) concentrations in groundwater samples with As(III) concentrations (except 40 μM of As(III)) were almost identical to the standard As(III) concentrations. The recovery rate was 84%–130% in groundwater. However, at 40 μM of As(III), the As(III) concentration determined by our method overestimated the As(III)-spiked concentration in groundwater. The As(V) concentrations determined by our method in groundwater (except 5 μM of As(V)) were almost identical to the As(V)-spiked concentration, and the recovery rate was between 100% and 117%, but when 5 μM of As(V) was determined, our method overestimated the As(V)-spiked concentration. The RSD of As(V) concentrations in groundwater measured by this simple As(V) analysis method varied from 6.7% to 148%.
Figure 5

Relationship between the concentrations of As(III)- and As(V)-spiked groundwater samples and those determined by using our method for determination of As(III) and As(V). The total concentration of As in each sample solution is 50 μM. The square dots show As(III) concentration and the circular dots show As(V) concentration.

Figure 5

Relationship between the concentrations of As(III)- and As(V)-spiked groundwater samples and those determined by using our method for determination of As(III) and As(V). The total concentration of As in each sample solution is 50 μM. The square dots show As(III) concentration and the circular dots show As(V) concentration.

Close modal

Discussion

In this study, the simple analytical method for As(III) using ssDNA sequences other than Ars-3 was performed based on a previous report (Zong & Liu 2019). As a result, calibration curves for As(III) were obtained even when ssDNA sequences other than Ars-3 were used as probe solutions. Zong & Liu (2019) reported that the ‘Ars-3 DNA is not an aptamer for As(III)’ and ‘As(III) adsorption on gold can produce the exact same color response for colorimetric sensing, although the DNA does not need to bind As(III).’ In this study, the As(III) concentration could be determined even when ssDNA other than Ars-3 was used in the probe solution, and the adsorption reaction of As(III) on the surface of AuNPs was considered to be more critical for this simple analytical method for As(III) than the binding reaction between Ars-3 and As(III). In addition, Zong & Liu (2019) reported that AuNPs and ssDNA have strong affinity for As(III), I, SO32−, and S2−. Thus, we suggest that the surface of AuNPs has specificity. However, according to other previous studies, simple analytical methods for As(III) based on Ars-3 using the devices (except AuNPs) have been developed (Oroval et al. 2017; Nguyen & Jang 2020), and it seems that these simple analytical methods for As(III) could quantify As(III) concentration by specific reaction between Ars-3 and As(III). Therefore, it is necessary to verify more carefully whether Ars-3 binds to As(III) or not.

In this study, we re-optimized the parameters for the simple analytical method for As(III) and As(V). In the simple analytical method for As(III), the final concentration of NaCl = 60 mM in the previous study (Matsunaga et al. 2019), while in this study, the final concentration of NaCl = 120 mM. This is because the dispersion of AuNPs differs among bottles. We suggest that the NaCl concentration for aggregation of AuNPs differs among the bottles. On the other hand, in the simple analytical method for As(V), the CeO2NPs used in the previous study (Matsunaga et al. 2022) and this study were from the same bottle. Thus we considered that each condition was the same as in the previous study (Matsunaga et al. 2022).

In this study, we combined the simple analytical methods for As(III) and As(V) to directly and simultaneously analyze As(III) and As(V) in a mixed sample of As(III) and As(V), respectively. Compared with previous studies, both the simplified As(III) and As(V) analytical methods optimized in this study have high detection limits (Zhan et al. 2014; Lopez et al. 2017), which are not less than the drinking water quality standards for As set by WHO and USEPA (WHO 2011; USEPA 2018). In the simple analytical method for As(III), the RSD was lower than in the previous study (Zhan et al. 2014), but the As(III) concentration determined by our method was overestimated. In the simple analytical method for As(V), the RSD was higher than in the previous study (Lopez et al. 2017). However, no previous study has directly and simultaneously determined As(III) and As(V) in groundwater using the simple analytical methods for As(III) and As(V) presented in this study. Our study shows the possibility of fractional determination using the simple analytical methods for As(III) and As(V).

We investigated the interaction between Ars-3 and As(III) on the surface of AuNPs using Ars-3 and other ssDNA sequences. When AuNPs alone were used as the probe solution, AuNPs aggregated with or without As(III). When AuNPs and ssDNA were used as the probe solution, calibration curves could be generated for any ssDNA sequences as the As(III) concentration increased. The slope of the calibration curve could increase using the other ssDNA shorter than Ars-3 (100-mer). Therefore, we found that As(III) could be adsorbed on the surface of AuNPs and that we could determine As(III) concentration by the simple analytical method for As(III) using AuNPs and ssDNA (sequence not specified). The Ars-3 could also make the calibration curve. We suggest that the simple analytical method for As(III) using Ars-3 and AuNPs developed in various previous studies is functional.

Furthermore, we performed the speciation analysis between As(III) and As(V) in ultrapure water and groundwater samples by a combination of our simple analytical methods for As(III) and As(V). We could determine As(III) and As(V) concentrations in ultrapure water and groundwater samples individually.

This research was supported financially by JSPS KAKENHI [grant number 21H04568, 17H03328, 20KK0090].

All relevant data are included in the paper or its Supplementary Information.

The authors declare there is no conflict.

Alauddin
M.
,
Alauddin
S. T.
,
Bhattacharjee
M.
,
Sultana
S.
,
Chowdhury
D.
,
Bibi
H.
&
Rabbani
G. H.
2003
Speciation of arsenic metabolite intermediates in human urine by ion-exchange chromatography and flow injection hydride generation atomic absorption spectrometry
.
Journal of Environmental Science and Health, Part A
38
(
1
),
115
128
.
Amini
M.
,
Abbaspour
K. C.
,
Berg
M.
,
Winkel
L.
,
Hug
S. J.
,
Hoehn
E.
,
Yang
H.
&
Johnson
C. A.
2008
Statistical modeling of global geogenic arsenic contamination in groundwater
.
Environmental Science & Technology
42
(
10
),
3669
3675
. http://dx.doi.org/10.1021/es702859e.
Ardini
F.
,
Dan
G.
&
Grotti
M.
2020
Arsenic speciation analysis of environmental samples
.
Journal of Analytical Atomic Spectrometry
35
(
2
),
215
237
.
Chung
C. J.
,
Huang
Y. L.
,
Huang
Y. K.
,
Wu
M. M.
,
Chen
S. Y.
,
Hsueh
Y. M.
&
Chen
C. J.
2013
Urinary arsenic profiles and the risks of cancer mortality: a population-based 20-year follow-up study in arseniasis-endemic areas in Taiwan
.
Environmental Research
122
,
25
30
.
http://dx.doi.org/10.1016/j.envres.2012.11.007
.
Das
J.
&
Sarkar
P.
2016
A new dipstick colorimetric sensor for detection of arsenate in drinking water
.
Environmental Science: Water Research & Technology
2
(
4
),
693
704
.
Flora
S. J. S.
2015
Handbook of Arsenic Toxicology
.
Academic Press, London, UK
.
Kaur
H.
,
Kumar
R.
,
Babu
J. N.
&
Mittal
S.
2015
Advances in arsenic biosensor development – a comprehensive review
.
Biosensors and Bioelectronics
63
,
533
545
.
http://dx.doi.org/10.1016/j.bios.2014.08.003
.
Kim
M.
,
Um
H. J.
,
Bang
S.
,
Lee
S. H.
,
Oh
S. J.
,
Han
J. H.
,
Kim
K. W.
,
Min
J.
&
Kim
Y. H.
2009
Arsenic removal from Vietnamese groundwater using the arsenic-binding DNA aptamer
.
Environmental Science & Technology
43
(
24
),
9335
9340
.
Lopez
A.
,
Zhang
Y.
&
Liu
J.
2017
Tuning DNA adsorption affinity and density on metal oxide and phosphate for improved arsenate detection
.
Journal of Colloid and Interface Science
493
,
249
256
.
http://dx.doi.org/10.1016/j.jcis.2017.01.037
.
Matsunaga
K.
,
Okuyama
Y.
,
Hirano
R.
,
Okabe
S.
,
Takahashi
M.
&
Satoh
H.
2019
Development of a simple analytical method to determine arsenite using a DNA aptamer and gold nanoparticles
.
Chemosphere
224
,
538
543
.
Nguyen
D. K.
&
Jang
C. H.
2020
Label-free liquid crystal-based detection of As(III) ions using ssDNA as a recognition probe
.
Microchemical Journal
156
,
104834
.
https://doi.org/10.1016/j.microc.2020.104834
.
Oroval
M.
,
Coll
C.
,
Bernardos
A.
,
Marcos
M. D.
,
Martínez-Máñez
R.
,
Shchukin
D. G.
&
Sancenón
F.
2017
Selective fluorogenic sensing of As(III) using aptamer-capped nanomaterials
.
ACS Applied Materials & Interfaces
9
(
13
),
11332
11336
.
Rasmussen
R. R.
,
Hedegaard
R. V.
,
Larsen
E. H.
&
Sloth
J. J.
2012
Development and validation of an SPE HG-AAS method for determination of inorganic arsenic in samples of marine origin
.
Analytical and Bioanalytical Chemistry
403
(
10
),
2825
2834
.
Singh
R.
,
Singh
S.
,
Parihar
P.
,
Singh
V. P.
&
Prasad
S. M.
2015
Arsenic contamination, consequences and remediation techniques: a review
.
Ecotoxicology and Environmental Safety
112
,
247
270
.
http://dx.doi.org/10.1016/j.ecoenv.2014.10.009
.
Sun
T.
,
Zhao
Z.
,
Liang
Z.
,
Liu
J.
,
Shi
W.
&
Cui
F.
2017
Efficient removal of arsenite through photocatalytic oxidation and adsorption by ZrO2–Fe3O4 magnetic nanoparticles
.
Applied Surface Science
416
,
656
665
.
http://dx.doi.org/10.1016/j.apsusc.2017.04.137
.
Tao
D.
,
Shi
C.
,
Guo
W.
,
Deng
Y.
,
Peng
Y.
,
He
Y.
,
Lam
P. K. S.
,
He
Y.
&
Zhang
K.
2022
Determination of As species distribution and variation with time in extracted groundwater samples by on-site species separation method
.
Science of the Total Environment
808
,
151913
.
https://doi.org/10.1016/j.scitotenv.2021.151913
.
USEPA
2018
National Primary Drinking Water Regulations
.
WHO
2011
Guidelines for Drinking-Water Quality
,
4th edn. World Health Organization, Geneva, Switzerland
.
Zhan
S.
,
Yu
M.
,
Lv
J.
,
Wang
L.
&
Zhou
P.
2014
Colorimetric detection of trace arsenic(III) in aqueous solution using arsenic aptamer and gold nanoparticles
.
Australian Journal of Chemistry
67
,
813
818
.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Licence (CC BY-NC-ND 4.0), which permits copying and redistribution for non-commercial purposes with no derivatives, provided the original work is properly cited (http://creativecommons.org/licenses/by-nc-nd/4.0/).

Supplementary data