The aim of this study was to determine the impact of continuous and intermittent aeration on the rate of ammonia removal in the combined nitritation–anammox process. This process was run in two parallel sequencing batch reactors (SBRs), with a working volume V = 10 L, treating sludge digester liquors from the Gdansk (Poland) wastewater treatment plant (WWTP). The ammonia oxidizing bacteria were cultivated from activated sludge from the same plant, whereas the anammox bacteria originated from the Zurich WWTP (Switzerland). Both SBRs were operated with 12-h cycles, temperature 30 °C and hydraulic residence time between 1 and 7 days depending on the operating period. The maximum specific ammonium utilization rate (sAUR) was observed in the reactor with intermittent aeration, and varied in the range of 4.4–4.7 g N kg VSS−1 h−1. The sAUR in the reactor with continuous aeration was slightly lower and ranged from 4.39 to 4.41 g N kg VSS−1 h−1. In the case of intermittent aeration, the additional measurement was performed at two different dissolved oxygen concentrations, i.e., 1 and 0.8 mg O2 L−1, and the observed nitrogen removal rates were 4.7 and 2.7 g N kg VSS−1 h−1, respectively.

INTRODUCTION

Anaerobic ammonium oxidation (anammox), in combination with a preceding step of partial nitrification (PN; nitritation), is a suitable solution for the treatment of liquids with a high content of ammonia nitrogen and a deficit of organic carbon, e.g., anaerobic sludge digestion effluents (reject water) in wastewater treatment plants (WWTPs). The combined nitritation–anammox process may be carried out in either one- or two-reactor systems. Joss et al. (2009) noted that the one-step sequencing batch reactor (SBR) has several advantages, including considerable simplification of reactor control and operation (e.g., no pH control), continuous depletion of nitrite, comparable anammox rates to two-stage systems, and significantly shorter start-up times. Conversely, the combination of nitritation and anammox in one reactor requires fragile oxygen conditions. In general, there are two principal methods of aeration, including continuous and intermittent. Continuous aeration during a reaction phase was proposed by Joss et al. (2009), whereas the use of intermittent aeration and stirring phases was proposed by Jeanningros et al. (2010), Yang et al. (2011) and Jardin & Hennerkes (2012). The reported time-based on/off control of aeration varied in the range 6–12 min (on) and 2–20 min (off). In most cases, the dissolved oxygen (DO) concentration in the aeration phase was kept below 0.4 mg O2 L−1, but it could be as high as 0.9–1 mg O2 L−1 (Gilbert et al. 2014). For applications with continuous aeration, the DO concentrations were usually kept extremely low, i.e., below 0.05 mg O2 L−1 (Christensson et al. 2013).

The appropriate aeration strategy (DO concentration and/or oxygenation frequency) is essential in order to ensure the suppression of nitrite oxidizing bacteria (NOB), which is necessary to carry out successfully a combined nitritation–anammox process. Many studies have focused on the performance of that process in SBRs in terms of the operational conditions, such as the applied nitrogen load, temperature, pH and DO concentration, while little is known about the impact of different aeration strategies (continuous vs. intermittent). In continuous aeration, the accumulation of nitrite at low DO concentrations may be attributed to the difference in the saturation constant for DO between ammonia oxidizing bacteria (AOB) and NOB. Values in the literature for the saturation constants of AOB and NOB range from 0.25 to 0.5 mg O2 L−1 and from 0.34 to 2.5 mg O2 L−1, respectively (Mota et al. 2005). In intermittent aeration, the duration of aeration and stirring phases is chosen based on a hypothesis that NOB need a longer lag phase after transition from anoxic to aerobic phases to fully restore their metabolism under aerobic conditions (Katsogiannis et al. 2003). It should also be emphasized that in sidestream treatment systems, the suppression of NOB could also result from higher temperatures, which favor AOB more than NOB. This effect is reflected by different Arrhenius temperature constants (θ) for both species of nitrifying bacteria, θAOB = 1.09–1.13 and θNOB = 1.05–1.07 (De Mulder 2014).

In this comparative study, two parallel laboratory-scale SBRs were seeded with sludge from a full-scale nitritation–anammox system and operated under different aeration conditions (continuous vs. intermittent aeration). The aim of this study was twofold. First, the two aeration modes were compared in terms of the combined nitritation–anammox process rates and the activity of anammox bacteria. Furthermore, the effect of DO concentration on the overall ammonia removal rates was examined in the intermittent aeration mode.

MATERIALS AND METHODS

Origin of the anammox biomass and reject water

For the experiments, activated sludge originating from a municipal biological nutrient removal WWTP was inoculated with anammox bacteria originating from a full-scale sidestream treatment system in Zurich (Switzerland). Both activated sludge and sludge digester liquors originated from the ‘Wschod’ WWTP (600.000 PE) in Gdansk (northern Poland). Prior to the inoculation of the anammox bacteria, NOB were washed out from the activated sludge by applying a sufficiently short retention time (1–2 days) at temperature T = 30 °C and pH = 7.5–8.2.

Experimental apparatus and operating conditions

Laboratory experiments were carried out in two parallel plexiglass SBRs (working volume V = 10 L each), equipped with a control system for DO, temperature (thermostatic jackets) and pH (Figure 1). In the course of this study, two different aeration methods were examined. In the first reactor (SBR1), the alternate short phases of aeration on/off (9/18 min), were used as recommended by Jardin & Hennerkes (2012). In the second reactor (SBR2), a continuous aeration mode was examined as recommended by Joss et al. (2009). In the latter case, the reaction phase was divided into two phases: aeration and stirring. The length of each phase was strictly dependent on the concentration of ammonia and nitrite in the reactor. In both reactors (SBR1 and SBR2), 12-h cycles were operated for 3 months. Each cycle consisted of the following four stages: aerobic fill, reaction phase with intermittent/continuous aeration modes, sedimentation, and decantation phase with different durations. The duration of each phase and main operational conditions of the SBRs are presented in Table 1. The pH fluctuated between 6.8 and 7.5, with the external control using sodium hydroxide (NaOH). The DO concentration was maintained at the level of 1 or 0.8 mg O2 L−1 (SBR1) and 0.4 mg O2 L−1 (SBR2) during the aeration periods. In both cases, two types of parallel measurements were carried out (TEST 1 and TEST 2), which are summarized in Table 2.

Table 1

Comparison of the operating cycles and operational conditions in SBR1 and SBR2

Parameters Units SBR1 SBR2 
Operating cycles 
 Feeding phase min 10 10 
 Reaction phase min 660 420–660 
 Sedimentation min 40 40 
 Decantation phase min 10 10 
Operational conditions 
 Reactor volume 10 10 
 Temperature °C 30 ± 1 30 ± 1 
 pH range  6.8–7.5 6.8–7.5 
 DO mg L−1 1.0 or 0.8 0.4 
 VSS g L−1 3.1 ± 0.25 3.3 ± 0.36 
 HRT 1.0–5.0 1.0–7.0 
Parameters Units SBR1 SBR2 
Operating cycles 
 Feeding phase min 10 10 
 Reaction phase min 660 420–660 
 Sedimentation min 40 40 
 Decantation phase min 10 10 
Operational conditions 
 Reactor volume 10 10 
 Temperature °C 30 ± 1 30 ± 1 
 pH range  6.8–7.5 6.8–7.5 
 DO mg L−1 1.0 or 0.8 0.4 
 VSS g L−1 3.1 ± 0.25 3.3 ± 0.36 
 HRT 1.0–5.0 1.0–7.0 

VSS: volatile suspended solids; HRT: hydraulic retention time.

Table 2

Summary of the laboratory experiments TEST 1 and TEST 2

Test Reactor Description 
TEST 1 
 A SBR NH4–N, NO2–N, NO3–N profiles performed in SBR1 with intermittent aeration (1 mg O2 L−1) after 7 days of adaptation 
SBR NH4–N, NO2–N, NO3–N profiles performed in SRB2 with continuous aeration after 7 days of adaptation 
 B SBR NH4–N, NO2–N, NO3–N profiles performed in SBR1 with intermittent aeration (1 mg O2 L−1) after 21 days of adaptation 
SBR NH4–N, NO2–N, NO3–N profiles performed in SRB2 with continuous aeration after 21 days of adaptation 
 C SBR Additional NH4–N, NO2–N, NO3–N profiles performed in SBR1 with intermittent aeration (0.8 mg O2 L−1
TEST 2 
 A Batch reactor Anammox activity test carried out using biomass taken from SBR1 with intermittent aeration (1 mg O2 L−1) after 9 days of incubation 
Batch reactor Anammox activity test carried out using biomass taken from SBR2 with continuous aeration after 9 days of incubation 
 B Batch reactor Anammox activity test carried out using biomass taken from SBR1 with intermittent aeration (1 mg O2 L−1) after 30 days of incubation 
Batch reactor Anammox activity test carried out using biomass taken from SBR2 with continuous aeration after 30 days of incubation 
 C Batch reactor Additional anammox activity test carried out using biomass taken from SBR1 with intermittent aeration (0.8 mg O2 L−1
Test Reactor Description 
TEST 1 
 A SBR NH4–N, NO2–N, NO3–N profiles performed in SBR1 with intermittent aeration (1 mg O2 L−1) after 7 days of adaptation 
SBR NH4–N, NO2–N, NO3–N profiles performed in SRB2 with continuous aeration after 7 days of adaptation 
 B SBR NH4–N, NO2–N, NO3–N profiles performed in SBR1 with intermittent aeration (1 mg O2 L−1) after 21 days of adaptation 
SBR NH4–N, NO2–N, NO3–N profiles performed in SRB2 with continuous aeration after 21 days of adaptation 
 C SBR Additional NH4–N, NO2–N, NO3–N profiles performed in SBR1 with intermittent aeration (0.8 mg O2 L−1
TEST 2 
 A Batch reactor Anammox activity test carried out using biomass taken from SBR1 with intermittent aeration (1 mg O2 L−1) after 9 days of incubation 
Batch reactor Anammox activity test carried out using biomass taken from SBR2 with continuous aeration after 9 days of incubation 
 B Batch reactor Anammox activity test carried out using biomass taken from SBR1 with intermittent aeration (1 mg O2 L−1) after 30 days of incubation 
Batch reactor Anammox activity test carried out using biomass taken from SBR2 with continuous aeration after 30 days of incubation 
 C Batch reactor Additional anammox activity test carried out using biomass taken from SBR1 with intermittent aeration (0.8 mg O2 L−1
Figure 1

Experimental setup consisting of two laboratory-scale SBRs.

Figure 1

Experimental setup consisting of two laboratory-scale SBRs.

TEST 1 involved the observation of the SBR operational cycle under the actual operating conditions, while the activity of anammox bacteria was monitored on-site in TEST 2 after dosing a synthetic mixture of NH4–N and NO2–N (Table 2). The latter tests were conducted in two parallel, plexiglass batch reactors with a working volume 4.0 L, equipped with a control system for temperature (F32-ME Refrigerated/Heating Circulator, JULABO GmbH, Seelbach, Germany). The tests were run under anoxic conditions, while maintaining a constant temperature of 30 °C and pH in the range of 6.8–7.5. The initial NH4–N concentrations in the activity tests were approximately 40 mg NH4–N L−1, and nitrite to ammonium molar ratio was kept constant at around 1. The average biomass concentrations in both reactors were only slightly different, i.e., 3.1–3.3 g VSS L−1 (Table 1). During the test, samples of mixed liquor were collected from the reactor with the frequency of 30–90 min and analyzed for NH4–N, NO3–N and NO2–N. Based on the measured NH4–N and NO2–N concentrations over time, two specific process rates were estimated, including the combined nitritation–anammox process rates (TEST 1) and anammox process rates (TEST 2). The obtained volumetric process rates (VPRs), were subsequently recalculated per unit concentration of volatile suspended solids (VSS).

Analytical methods

Samples of mixed liquor were filtered through 1.2 μm pore-size nitrocellulose membrane filters (Whatman, Kent, UK). Concentrations of the inorganic N forms (NH4–N, NO3–N and NO2–N) were determined spectrophotometrically with cuvette tests (Hach Lange GmbH, Dusseldorf, Germany) using a Xion 500 spectrophotometer (Dr Lange GmbH, Berlin, Germany). The analytical procedures, which were adopted by Dr Lange, followed Standard Methods (APHA 2005). The mixed liquor suspended solids and mixed liquor volatile suspended solids (MLVSS) concentrations were determined at the beginning of the tests by the gravimetric method according to Polish Standards (PN-72/C-04559).

Microbiological methods

Microbiological analyses were made in order to verify the sludge composition in terms of the content of AOB and anammox bacteria. Grab samples for the analyses were withdrawn from reactors SBR1 and SBR2 at an interval of 1 month. The DNA extraction was obtained by a mechanical breakdown of the cell wall and DNA purification in silicone columns. Isolated DNA was amplified using the polymerase chain reaction (PCR) technique; 50 ng of DNA was added to the PCR mixture (30 μL). The temperature and time of each reaction step is shown in Table 3, whereas the sequence of primers used for PCR identification is presented in Table 4. The products were subsequently visualized on agarose gel under UV light.

Table 3

PCR cycling conditions

PCR reaction steps Time, min Temperature, °C 
Primer extension 10 95 
35 polymerase reaction cycles with each comprising: 
 Denaturation step 94 
 Annealing step 54 
 Extension step 72 
Final extension 10 72 
PCR reaction steps Time, min Temperature, °C 
Primer extension 10 95 
35 polymerase reaction cycles with each comprising: 
 Denaturation step 94 
 Annealing step 54 
 Extension step 72 
Final extension 10 72 
Table 4

Sequence of starters used for PCR identification

 Primer sequences Application to References 
Pla46f-GC
907r 
CGCCCGCCGCGCGCGGCGGGCGGGGCGG
GGGCACGGGGGGGGATTAGGCATGCAAGTC 
Anammox Innerebner et al. (2007)  
908 CCGTCAATTCCTTTGAGTTT Anammox Innerebner et al. (2007)  
CTO189f
– ABC – 
CCG CCG CGC GGC GGG CGG GGC GGG GGC
ACG GGGGGACMAAAGYAGGGGAT G 
AOB Kowalchuk & Stephen (2001)  
CTO 654r CTAGCYTTGTAGTTTCAAACGC AOB Kowalchuk & Stephen (2001)  
338F GCCGC CCG CCG CGC GCG GCG GGC GGG GCGGGG GCA CGG GGG GCC TAC GGG AGG CAGCAG AOB Kowalchuk & Stephen (2001)  
518r ATT ACC GCG GCT GCT GG AOB Kowalchuk & Stephen (2001)  
 Primer sequences Application to References 
Pla46f-GC
907r 
CGCCCGCCGCGCGCGGCGGGCGGGGCGG
GGGCACGGGGGGGGATTAGGCATGCAAGTC 
Anammox Innerebner et al. (2007)  
908 CCGTCAATTCCTTTGAGTTT Anammox Innerebner et al. (2007)  
CTO189f
– ABC – 
CCG CCG CGC GGC GGG CGG GGC GGG GGC
ACG GGGGGACMAAAGYAGGGGAT G 
AOB Kowalchuk & Stephen (2001)  
CTO 654r CTAGCYTTGTAGTTTCAAACGC AOB Kowalchuk & Stephen (2001)  
338F GCCGC CCG CCG CGC GCG GCG GGC GGG GCGGGG GCA CGG GGG GCC TAC GGG AGG CAGCAG AOB Kowalchuk & Stephen (2001)  
518r ATT ACC GCG GCT GCT GG AOB Kowalchuk & Stephen (2001)  

The microbial community, consisting mainly of anammox bacteria and AOB, was analysed by means of denaturing gradient gel electrophoresis (DGGE). DGGE was conducted at 60 °C in 1 × TAE buffer at 60 V for 12 h on a Dcode Mutation Detection system (Bio-Rad Laboratories, Hercules, CA, USA) on a 6% of polyacrylamide gel with 30–60% denaturing gradient. Results were visualized under UV light and photographed using KODAK 1 D 3, 6 Image Analysis Software (Eastman Kodak Company, Rochester, NY, USA).

No quantitative or qualitative analyses of NOB have been made in this study. The suppression of NOB was indirectly monitored based on the behavior of NO3–N.

RESULTS AND DISCUSSION

Microbiological analyses

Results of the microbiological analyses are presented in Figure 2. The sampling was performed in both reactors at the beginning of the study (samples nos 1 and 4), after a month (samples nos 2 and 5), and after 2 months of the operation (only SBR1 – sample no. 3). The results obtained from the separation of PCR products by DGGE revealed that there was no differentiation of AOB species in both SBRs (Figure 2(a)). The PCR results indicated that the number of anammox bacteria was increasing in both reactors (Figure 2(b)).

Figure 2

Microbiological analyses used for identification of the microbial community (a) separation of PCR products by DGGE in order to examine the diversity of AOB; (b) PCR detection of anammox bacteria (1,2,3 - samples from SBR1; 4,5 - samples from SBR2; M-marker).

Figure 2

Microbiological analyses used for identification of the microbial community (a) separation of PCR products by DGGE in order to examine the diversity of AOB; (b) PCR detection of anammox bacteria (1,2,3 - samples from SBR1; 4,5 - samples from SBR2; M-marker).

Kinetic tests

The quality of sludge digester liquors at the Wschod WWTP is highly variable (Table 5). In this study, NH4–N concentrations generally ranged around 1,000 g N m−3, whereas the average chemical oxygen demand (COD) concentration was 609 ± 249 g O2 m−3. The ratio COD/total nitrogen (TN) remained in the range 0.53–0.62, which is similar to the ratio 0.5 found in the study of Joss et al. (2009).

Table 5

Characteristics of sludge digester liquors from the Wschod WWTP in Gdansk

 TN g N m−3 NH4–N g N m−3 NO3–N g N m−3 COD g O2 m−3 COD/Ntotal 
This study 1130 ± 56 1023 ± 217 1.9 ± 0.54 609 ± 249 0.53–0.62 
Czerwionka et al. (2014)  889 ± 37 760 ± 187 1.4 ± 0.97 1.491 ± 673 – 
 TN g N m−3 NH4–N g N m−3 NO3–N g N m−3 COD g O2 m−3 COD/Ntotal 
This study 1130 ± 56 1023 ± 217 1.9 ± 0.54 609 ± 249 0.53–0.62 
Czerwionka et al. (2014)  889 ± 37 760 ± 187 1.4 ± 0.97 1.491 ± 673 – 

Results from the two types of experiments (TEST 1 and TEST 2), carried out in SBR1 and SBR2 are presented in Figures 345. Figure 3 illustrates the results of measurements performed on day 7 (TEST 1A) and day 21 (TEST 1B). Slightly higher specific ammonium utilization rates (sAURs) were observed in SBR1 with intermittent aeration. The rates in SBR1 were 4.4 (TEST 1A) and 4.7 g N kg VSS−1h−1 (TEST 1B) compared to the rates of 4.39 (TEST 1A) and 4.41 g N kg VSS−1h−1 (TEST 1B) in SBR2 with continuous aeration.

Figure 3

NH4–N, NO2–N and NO3–N concentrations during TEST 1A (after 7 days of incubation) and TEST 1B (after 21 days of incubation) of the nitritation–anammox process at 30 °C with continuous and intermittent aeration (9 min aeration and 18 min stirring).

Figure 3

NH4–N, NO2–N and NO3–N concentrations during TEST 1A (after 7 days of incubation) and TEST 1B (after 21 days of incubation) of the nitritation–anammox process at 30 °C with continuous and intermittent aeration (9 min aeration and 18 min stirring).

Figure 4

NH4–N, NO2–N and NO3–N concentrations during TEST 2A (after 9 days of incubation) and TEST 2B (after 30 days of incubation) of the nitritation–anammox process at 30 °C with continuous and intermittent aeration (9 min aeration and 18 min stirring).

Figure 4

NH4–N, NO2–N and NO3–N concentrations during TEST 2A (after 9 days of incubation) and TEST 2B (after 30 days of incubation) of the nitritation–anammox process at 30 °C with continuous and intermittent aeration (9 min aeration and 18 min stirring).

Figure 5

NH4–N, NO2–N and NO3–N concentrations during the nitritation–anammox process at 30 °C with intermittent aeration (9 min aeration and 18 min stirring) at the DO concentration of (a) 1.0 mg O2 L−1; (b) 0.8 mg O2 L−1.

Figure 5

NH4–N, NO2–N and NO3–N concentrations during the nitritation–anammox process at 30 °C with intermittent aeration (9 min aeration and 18 min stirring) at the DO concentration of (a) 1.0 mg O2 L−1; (b) 0.8 mg O2 L−1.

Results concerning the activity of anammox bacteria derived from day 9 (TEST 2A) and day 30 (TEST 2B) are presented in Figure 4. The activity of anammox bacteria was slightly higher in the reactor with intermittent aeration (SBR1). The anammox process rate reached 0.36 (TEST 2A) and 0.53 kg N m−3d−1 (TEST 2B) for the system with intermittent aeration, while the corresponding rates in the system with continuous aeration were 0.41 (TEST 2A) and 0.48 kg N m−3d−1 (TEST 2B). The nitrogen removal efficiencies in SBR1 and SBR2 were 72–89% and 5–90%, respectively. Nitrite accumulated at the concentration around 120 mg N L−1 after 21 days of incubation in SBR2, which resulted in a significant decrease in the nitrogen removal efficiency of the combined nitritation–anammox process. However, there was no irreversible inhibitory effect on anammox bacteria, as confirmed by the results of TEST 2B and microbiological analyses.

In the case of SBR1, reduction of the DO concentration from 1 to 0.8 mg O2 L−1 also resulted in a decrease of the sAUR from 4.7 (Figure 5(a)) to 2.7 g N kg VSS−1 h−1 (TEST 2C, Figure 5(b)). Simultaneously, the anammox process rate slightly decreased from 0.53 to 0.48 kg N m−3d−1. To evaluate the effects of the aeration system and specific reactor configuration on the actual supply of DO, a volumetric oxygen transfer coefficient (KLa) was determined based on mass balance equations. Values obtained in both reactors were comparable, i.e., 1.88 h−1 (SBR1) and 1.92 h−1 (SBR2). This proves that various process rates occurring in the SBRs resulted from the different operational strategies rather than technical parameters affecting the oxygen transfer in specific reactors.

The observed sAURs in SBR1 and SBR2, 4.4–4.7 g N kg VSS−1 h−1, were slightly higher compared to those obtained in the conventional nitrification/denitrification (N/DN) processes, 3–4 g N kg VSS−1 h−1 (Table 6). The combined nitritation–anammox process rates in SBR1 and SBR2 were consistent with the results obtained by Joss et al. (2009) for a similar type of anammox sludge (Swiss WWTP) and other laboratory-scale anammox type systems (Cho et al. 2011; Daverey et al. 2013). For comparison, Table 6 also shows the reported nitrogen removal rates and efficiencies in different biological nitrogen removal systems, including both conventional N/DN and innovative processes, such as PN and anammox. The reported VPRs for the conventional processes range from 0.0013 (Carrera et al. 2003) up to 3.0–3.6 kg N m−3 d−1 (Fux et al. 2006), depending on the local process conditions. In the case of the innovative, anammox-type processes, the range of reported VPRs is even broader, i.e., 0.01–8.9 kg N m3 d−1. The highest rate was reported by Sliekers et al. (2003), who also reviewed the reported rates for other systems (0.05–7.0 kg N m3 d−1). Daverey et al. (2013) observed profound VPR variations, i.e., 0.01–0.909 kg N m3 d−1, in the long-term performance of a CANON system. The lowest rates were observed at high DO exposure (>1 mg L−1) and high nitrite concentration (>100 mg L−1). The inhibition due to high DO exposure was found to be a reversible phenomenon, whereas the synergistic inhibition of nitrite, free ammonia and free nitrous acid was irreversible. In contrast to laboratory-scale systems, the typical nitrogen removal rates achieved in full-scale anammox-type processes treating anaerobic sludge digester liquors remained in a relatively narrow range 0.3–0.7 kg N m−3 d−1 (Rosenwinkel et al. 2009; Vazquez-Padin et al. 2009).

Table 6

Nitrogen removal rates and efficiencies reported for different biological nitrogen removal systems for the treatment of anaerobic sludge digester liquors, including conventional nitrification/denitrification (N/DN), partial nitrification (PN) and anammox

Source Process Type of reactor VPR [kg N m3 d−1sAUR [g N kg VSS−1h−1N-removal efficiency, % 
Makinia et al. (2011)  N/DN SBR – 4.02–4.06 – 
Carrera et al. (2003)  N/DN SBR 0.0013 – – 
Fux et al. (2006)  N/DN SBR 3.0–3.6 – 87 
Gali et al. (2007)  PN SBR 1.1 ± 0.1 42 ± 2 50 
SHARON 0.35 ± 0.05 39 ± 2 50 
Dosta et al. (2007)  PN SBR 0.87 19 – 
Cho et al. (2011)  PN  0.23 ± 0.16 – 22.1 ± 15.7 
Anammox  0.35 ± 0.19 – 16.6 ± 8.9 
Dapena-Mora et al. (2004)  Anammox SBR 0.7 18.33 78 
This study 
 SBR1a Anammox SBR 0.360–0.528 – 87–95 
 SBR2b 0.408–0.480 – 65–70 
Sliekers et al. (2003)  Anammox Gas-lift 8.9± 0.2 – 93 
 PN/Anammox Gas-lift 1.5 ±0.2 – 92 
Joss et al. (2009)  PN/Anammox SBR 0.090–0.510 – – 
Daverey et al. (2013)  PN/Anammox SBR 0.01–0.909 – 60–89 
This study 
 SBR1a PN/Anammox SBR 0.245–0.262 4.40–4.70 72–89 
 SBR2b 0.151–0.163 4.39–4.41 5–90 
Source Process Type of reactor VPR [kg N m3 d−1sAUR [g N kg VSS−1h−1N-removal efficiency, % 
Makinia et al. (2011)  N/DN SBR – 4.02–4.06 – 
Carrera et al. (2003)  N/DN SBR 0.0013 – – 
Fux et al. (2006)  N/DN SBR 3.0–3.6 – 87 
Gali et al. (2007)  PN SBR 1.1 ± 0.1 42 ± 2 50 
SHARON 0.35 ± 0.05 39 ± 2 50 
Dosta et al. (2007)  PN SBR 0.87 19 – 
Cho et al. (2011)  PN  0.23 ± 0.16 – 22.1 ± 15.7 
Anammox  0.35 ± 0.19 – 16.6 ± 8.9 
Dapena-Mora et al. (2004)  Anammox SBR 0.7 18.33 78 
This study 
 SBR1a Anammox SBR 0.360–0.528 – 87–95 
 SBR2b 0.408–0.480 – 65–70 
Sliekers et al. (2003)  Anammox Gas-lift 8.9± 0.2 – 93 
 PN/Anammox Gas-lift 1.5 ±0.2 – 92 
Joss et al. (2009)  PN/Anammox SBR 0.090–0.510 – – 
Daverey et al. (2013)  PN/Anammox SBR 0.01–0.909 – 60–89 
This study 
 SBR1a PN/Anammox SBR 0.245–0.262 4.40–4.70 72–89 
 SBR2b 0.151–0.163 4.39–4.41 5–90 

aIntermittent aeration.

bContinuous aeration.

Factors such as DO and nitrite concentrations, and the COD/N ratio explicitly have a dominant inhibitory effect on the nitritation–anammox process. The DO concentration is an important control variable and should be kept at a certain level. On the one hand, AOB should be allowed to produce a sufficient amount of NO2–N for the anammox process. On the other hand, the produced amounts of NO2–N should not be too high, due to a potential anammox inhibition effect and increased growth of NOB. In the literature (Lotti et al. 2012), the adverse effect of nitrite is referred to as reversible inhibition, irreversible inhibition and toxic, which depends on the actual NO2–N concentration and exposure time. For example, Strous et al. (1999) and Daverey et al. (2013) found that NO2–N concentrations higher than 100 mg L−1 caused inhibition of the anammox process. In this study, a similar situation occurred in the SBR2 with continuous aeration, where a temporary accumulation of nitrite was observed (Figure 3) and the maximum recorded NO2–N concentrations reached approximately 120 mg L−1. The nitrite inhibition may be a reason for the lower rates observed in SBR2.

The higher nitrogen removal rates obtained in SBR1 may also be attributed to the applied mode of aeration. It should be emphasized that intermittent aeration, or more specifically the length of individual phases, favors the suppression of NOB. Kornaros et al. (2010) emphasized that the use of the lag phase concept exhibited by NOB under alternating aerobic/anoxic conditions is vital, as it does not require any addition of chemicals or extreme growth conditions (e.g., temperature), other than a simple manipulation of the operating conditions. Yoo et al. (1999) found that the lag phase of NOB when transitioning from anoxic to aerobic conditions was the most important factor for active nitritation and suppressed nitratation. In this study, the length of air on/off phases was selected based on the findings of Jardin & Hennerkes (2012) and Gilbert et al. (2014) who observed the successful suppression of NOB activity when the length of the anoxic period was 18 min. Furthermore, Gilbert et al. (2014) found that the actual length of a lag phase depended mainly on the NOB species and availability of DO.

Too high a concentration of COD and COD/N ratio could influence the nitrogen removal rate in the anammox process because anammox bacteria are not able to compete with denitrifying bacteria. Chamchoi et al. (2008) and Ni et al. (2012) found that the suppression of anammox activity occurred at the COD/N ratio higher than 2.0 and 4.0, respectively. In this study, however, the influent COD/N ratio remained in the range 0.53–0.62, which should not have a negative effect on the activity of anammox bacteria.

CONCLUSIONS

The use of different aeration methods revealed that both types of aeration approaches (intermittent vs. continuous), together with different DO concentrations, have a significant impact on the observed nitritation–anammox rates. Higher process rates and more stable operation were obtained in the SBR with intermittent aeration. The high concentrations of nitrite (>100 mg L−1) accumulated in the SBR with continuous aeration explicitly had no irreversible inhibitory effect on the anammox activity as confirmed by the results of microbiological analyses and anammox activity measurements. In the case of intermittent aeration, not only the length of the air on/off phases, but also the higher DO concentration (1 vs. 0.8 mg O2 L−1) significantly increased the nitrogen removal rate in the one-stage nitritation–anammox system under study.

ACKNOWLEDGEMENT

This study has been financially supported by the National Science Centre (Poland) under project no. UMO-2011/01/B/ST8/07289.

REFERENCES

REFERENCES
APHA
2005
Standard Methods for the Examination of Water and Wastewater
,
21st edn
.
American Public Health Association
,
Washington, DC
,
USA
.
Christensson
M.
Ekström
S.
Andersson
C. A.
Le Vaillant
E.
Lemaire
R.
2013
Experience from start-ups of the first ANITA Mox Plants
.
Water Sci. Technol
67
,
2677
2684
.
Dapena-Mora
A.
Campos
J. L.
Mosquera-Corral
A.
Jetten
M. S.
Mendez
R.
2004
Stability of the ANAMMOX process in a gas-lift reactor and a SBR
.
J. Biotechnol.
110
,
159
170
.
De Mulder
C.
2014
Impact of intrinsic and extrinsic parameters on the oxygen kinetic parameters of ammonia and nitrite oxidizing bacteria
.
Master's thesis
,
Ghent University, Faculty of Bioscience Engineering, Ghent Belgium
.
Gilbert
E. M.
Agrawal
S.
Brunner
F.
Schwartz
T.
Horn
H.
Lackner
S.
2014
Response of different Nitrospira species to anoxic periods depends on operational DO
.
Environ. Sci. Technol.
48
,
2934
2941
.
Jeanningros
Y.
Vlaeminck
S. E.
Kaldate
A.
Verstaete
W.
Graveleau
L.
2010
Fast start-up of a pilot-scale deammonification sequencing batch reactor from an activated sludge inoculum
.
Water Sci. Technol.
61
,
1393
1400
.
Joss
A.
Salzgeber
D.
Eugster
J.
König
R.
Rottermann
K.
Burger
S.
Fabijan
P.
Leumann
S.
Mohn
J.
Siegrist
H.
2009
Full-scale nitrogen removal from digester liquid with partial nitritation and anammox in one SBR
.
Environ. Sci. Technol.
43
,
5301
5306
.
Katsogiannis
A. N.
Kornaros
M.
Lyberatos
G.
2003
Enhanced nitrogen removal in SBRs bypassing nitrate generation accomplished by multiple aerobic/anoxic phase pairs
.
Water Sci. Technol.
47
(
11
),
53
59
.
Kowalchuk
G. A.
Stephen
J. R.
2001
Ammonia-oxidizing bacteria: a model for molecular microbial ecology
.
Annu. Rev. Microbiol.
55
,
485
529
.
Lotti
T.
van der Star
W. R. L.
Kleerebezem
R.
Lubello
C.
van Loosdrecht
M. C. M.
2012
The effect of nitrite inhibition on the anammox process
.
Water Res.
46
,
2559
2569
.
Makinia
J.
Czerwionka
K.
Oleszkiewicz
J.
Kulbat
E.
Fudala-Ksiazek
S.
2011
A distillery by-product as an external carbon source for enhancing denitrification in mainstream and sidestream treatment processes
.
Water Sci.
Technol.
64
,
2072
2079
.
Mota
C.
Head
M. A.
Ridenoure
J. A.
Cheng
J. J.
de Los Reyes
F. L.
III
2005
Effects of aeration cycles on nitrifying bacterial populations and nitrogen removal in intermittently aerated reactors.
Appl.
Environ. Microbiol.
71
(
12
),
8565
8572
.
Ni
S. Q.
Ni
J. Y.
Hu
D. L.
Sung
S.
2012
Effect of organic matter on the performance of granular anammox process
.
Biores. Technol.
110
,
701
704
.
Polish Standards PN-72/C-04559/02
1972
Oznaczanie zawiesin ogólnych, mineralnych i lotnych metodą wagową (Determination of general, mineral and volatile suspended matter by means of the gravimetric method). Polish Standardization Committee, Warsaw, Poland.
Rosenwinkel
K.-H.
Beier
M.
Phan
L.-C.
Hartwig
P.
2009
Conventional and advanced technologies for biological nitrogen removal in Europe
.
Water Pract. Technol.
4
(
1
).
Sliekers
A. O.
Third
K. A.
Abma
W.
Kuenen
J. G.
Jetten
M. S. M.
2003
CANON and anammox in a gas-lift reactor FEMS
.
Microbiol
. Letters
218
,
339
344
.
Strous
M.
Kuenen
J. G.
Jetten
M. S. M.
1999
Key physiology of anaerobic ammonium oxidation
.
Appl. Environ. Microbiol
65
,
3248
3250
.
Vazquez-Padin
J.
Pozo
M.
Jarpa
M.
Figueroa
M.
Franco
A.
Mosqueral-Corral
A.
Campos
J. L.
Mendez
R.
2009
Treatment of anaerobic sludge digesters effluent by the CANON process in an air pulsing SBR
.
J. Hazard. Mater.
166
,
336
341
.
Yang
J.
Zubrowska-Sudol
M.
Trela
J.
Plaza
E.
2011
Influence of aeration conditions on nitrogen removal rate in one-stage partial nitrification/anammox process
. In:
Proceedings of the Water Environment Federation
,
Nutrient Recovery and Management
, pp.
1053
1066
.