Abstract

In wastewater treatment plants the antagonistic activities of actinomycetes could be contributing significantly in microbe-removing mechanisms, which are a combination of different factors. For this purpose, out of 58 actinomycetes isolates from a wastewater treatment plant in Al-Fayoum Governorate, Egypt, only 36 different morphological isolates were selected for further studies. Although 35 isolates (97.23%) were active against one or more of tested bacteria, WD5 isolate had broad-spectrum antagonistic activity against both Gram-negative and Gram-positive tested bacteria. WD5 ethyl acetate extract recorded the highest antibacterial activity against Staphylococcus aureus MTCC 96 (23 mm) and the lowest antibacterial activity against Pseudomonas aeruginosa MTCC 2453 (11 mm). Gas chromatography-mass spectrometry analysis of extract using available NIST (National Institute of Standards and Technology) library data identified seven bioactive compounds: 2-methylbutyl acetate, 3′,5′-dinitrobenzoic acid, 1-octadecene, tetradecane, dodecane, docosane, and methylamine,N,N-bis(N.-decyl). Many earlier studies mentioned the antibacterial activity of all above seven compounds. The 16S rRNA sequence of WD5 was recorded in GenBank under the accession number MK491056 and confirmed by comparing it with the known 16S rRNA sequences in GenBank as Streptomyces sp. These results indicated antagonistic activity of actinomycetes in the removal of wastewater-associated bacteria.

INTRODUCTION

Great numbers of microorganisms are released into the aquatic environments. These microorganisms are then distributed into surface water such as rivers, lakes, and groundwater increasing microbial infections in the human population (George et al. 2002; Reynolds & Barrett 2003; Gerba & Smith 2005; Arnone & Walling 2007). In less developed countries, pathogens enter the aquatic environments through active discharge or leakages into sanitation systems (Seidel et al. 2016).

Despite the aquatic environment being considered a hostile place for pathogens, where starvation, inactivation, and decay generally occur, more diversity of pathogenic microorganisms is detected in surface water receiving wastewater. Escherichia coli, Vibrio cholerae, and Yersinia enterocolitica, as well as species of the genera Salmonella and Legionella are clear examples of the pathogenic bacteria regularly found in surface and subsurface water. Although most pathogens require specific conditions for survival, some pathogenic bacteria such as Pseudomonas aeruginosa, E. coli, and species of the genera Legionella and Mycobacterium have been found repeatedly surviving and multiplying outside their human hosts (Vital et al. 2007; Olsen et al. 2010; Cheng et al. 2012). With increasing of the human population many countries are tending toward wastewater treatment for water reuse to reduce the demand on potable water supplies.

In wastewater treatment plants, the primary sedimentation, conventional secondary biological treatment, and disinfection methods (e.g. ultraviolet (UV), ozonation and chlorination) are very efficient for the rapid removal of contaminating microorganisms (Sonune & Ghate 2004). Inactivation of pathogen survival in aquatic environments depends on a broad range of abiotic factors, the core drivers of pathogenic inactivation and degradation being, for example, UV irradiation, the changes in water ionic strength and temperature (Sinton et al. 2002; Sadeghi et al. 2011). In addition to the influence of abiotic factors for removal and inactivation of pathogens, other influences include biotic antagonistic interactions (i.e., negative interactions between microorganisms) on the fate of incoming pathogenic microorganisms into the aquatic environment. In the environment, microorganisms form a complex interactive network of commensalism, synergistic, antagonism, and parasitism. The antagonism between microorganisms actively contributes to the pathogen inactivation and elimination (Hibbing et al. 2010).

A variety of antimicrobial substances such as secondary metabolites, extracellular enzymes or antibiotics are naturally produced by microbes, giving them a competitive advantage in their microbial war (Jack et al. 1995).

The use of microorganisms as a source of bioactive substances has received considerable attention of researchers. Actinomycetes, especially the Streptomyces genus, are widely recognized as important microorganisms and serve as the source of life-saving environments as they are a rich source of several useful bioactive natural products with potential applications as antibacterial (e.g. streptomycin, tetracycline, and chloramphenicol), antifungal (e.g. nystatin), antiviral (e.g. tunicamycin), antiparasitic (e.g. avermectin), immunosuppressive (e.g. rapamycin), and antitumor (e.g. actinomycin, mitomycin C, and anthracyclines) agents as well as important enzymes (Bérdy 2005).

Actinomycetes are aerobic, spore forming Gram-positive bacteria, belonging to the order Actinomycetales which are characterized by substrate and aerial mycelium growth. Isolation and screening of strains of actinomycetes producing potential secondary metabolites has captured the attention of researchers for many years (Hacène et al. 2000). About two-thirds of currently reported natural bioactive compounds belonging to different types of chemical groups have been isolated from actinomycetes. Wastewater might be a rich source of actinomycetes producing antimicrobial compounds and involved in the removal of wastewater-associated bacteria. Thus, the objectives of this study were to isolate antagonistic actinomycetes originating from wastewater and to screen the antagonistic activity of isolated actinomycetes against wastewater-associated bacteria. Finally, the antibacterial activity of ethyl acetate extract of an efficient isolate was studied to determine antibacterial compounds.

MATERIALS AND METHODS

Collection of wastewater samples

The samples for isolation of actinomycetes were collected from wastewater treatment plant in Al-Fayoum Governorate (secondary treatment for domestic wastewater), Egypt. The samples were collected in sterile plastic bottles from three sites in plant representing the main different stages: the influent, the sedimentation tank, and the effluent.

Isolation of actinomycetes

The membrane filtration method was used for isolation of actinomycetes from wastewater samples. The samples were filtrated on a 0.45 μm pore size cellulose membrane filter (Sartorius); then, the filter was put on the surface of nutrient agar medium and was allowed to incubate for 5 days at 28 °C where the mycelium of actinomycetes penetrated the membrane filter but bacteria remained on the surface of the membrane. After incubation, the filter was removed and the plates were incubated for another 3 days to allow the growth of actinomycetes (Hirsch & Christensen 1983).

Screening of actinomycetes isolates for antagonistic activity

Primary screening

The perpendicular streak method on nutrient agar plates was used for primary screening of isolates. A single streak of each actinomycetes isolate was made as a straight line in the center of nutrient agar medium and incubated at 28 °C for 3–4 days to permit growth and antibacterial agent production. The overnight reference bacterial strains (Gram-positive bacteria: Staphylococcus aureus MTCC 96, Bacillus subtilis MTCC 736, and Enterococcus faecalis ATCC 29212, and Gram-negative bacteria: Escherichia coli MTCC 739, Pseudomonas aeruginosa MTCC 2453, and Aeromonas hydrophila ATCC 14715, which were obtained from the Department of Microbiology, Woman College, Ain Sham University, Egypt) were streaked perpendicular to the original growth of actinomycetes and incubated at 37 °C for 24 hrs. If the tested bacterial organism was susceptible to the antibacterial agent produced by actinomycetes, bacteria would not grow near the actinomycetes. The inhibition of bacteria around the actinomycetes was taken as positive for antagonistic activity. The control plate was inoculated by tested bacteria without the actinomycetes to assess the normal growth of bacteria.

Extraction of the antibacterial agents

The selected actinomycetes isolates were inoculated in starch casein broth (soluble starch: 10 g, K2HPO3: 2 g, KNO3: 2 g, casein: 0.3 g, MgSO4.7H2O: 0.05 g, CaCO3: 0.02 g, FeSO4.7H2O: 0.01 g and NaCl: 2 g) and incubated at 28 °C for 7 days. After incubation, the culture was filtrated by a 0.45 μm filter. The antibacterial agents were extracted from filtrate using organic solvent extraction (Liu et al. 1986). Ethyl acetate was added to the filtrate in ratio 1:1 (V:V) and incubated on a shaker (120 rpm) for 1 hr to complete extraction. The ethyl acetate phase (organic layer) which contained antibacterial agent was separated from the aqueous phase (aqueous layer) using a 250 mL capacity separating funnel. The organic layer was evaporated to dryness in a water bath at 80–90 °C. The dried precipitate was dissolved in a minimum amount of ethyl acetate and was used to determine antibacterial activity.

Secondary screening

Antibacterial activity of extract was determined by the agar well diffusion method in accordance with that prescribed by WHO (World Health Organization) for the modified Kirby–Bauer technique (Valli et al. 2012). Crude extract of antibacterial compound obtained by ethyl acetate extraction was used. One hundred microlitres of extracted compound was loaded into wells bored in plates that were previously swabbed with different tested bacteria (only one organism in each plate) (the density of bacterial suspensions was adjusted to equal that of McFarland turbidity standard 0.5, which is approximately equal to 1 × 108 cells/mL). After incubation at 37 °C for 24 hrs, the zone diameter of inhibition was measured to the nearest millimetre. The formation of any inhibition zone around the well indicated the presence of antibacterial agents in the extract.

Gas chromatography-mass spectrometry analysis

The crude ethyl acetate extract of the highest antagonistic isolate was subjected to gas chromatography-mass spectrometry (GC-MS) analysis using a Thermo Scientific Trace GC Ultra/ISQ Single Quadruple MS and TG-5MS fused silica capillary column (30 m, 0.251 mm, 0.1 mm film thickness). For GC-MS detection, an electron ionization system with ionization energy of 70 eV was used and helium gas was used as the carrier gas at a constant flow rate of 1 mL/min. The injector and MS transfer line temperature were set at 280 °C. The oven temperature was programmed at an initial temperature 150 °C (held 4 min) and increased to 280 °C as a final temperature at a rate of 5 °C /min (held 4 min). The spectrum of components was investigated using the percent relative peak area. A tentative identification of the compounds was performed based on the comparison of their relative retention time and mass spectra with typical mass spectra from the NIST (National Institute of Standards and Technology) libraries which were provided by the software of the GC-MS system (Wiley GC-MS-2007 system) (Al-Tameme et al. 2015).

Identification using 16S rRNA sequencing

The actinomycetes isolate with highest antagonistic activity against tested bacteria was selected for 16S rRNA sequencing studies. The isolate was inoculated in starch casein broth and incubated at 28 °C for 7 days. Genomic DNA was extracted with a Quick-DNA Miniprep Plus Kit (Zymo Research Corp., USA). The 16S rRNA universal primers gene fragment was amplified by the polymerase chain reaction (PCR) method where purified genomic DNA was used as a template. Forward primer (5′ AGAGTTTGATCCTGGCTCAG 3′) and reverse primer (5′ ACGGCTACCTTGTTACGACTT 3′) were used as primers, and PCR reaction was performed by the following condition: initial denaturation at 94°C for 6 minutes followed by 35 amplification cycles at 94°C for 45 seconds, annealing at 56 °C for 45 seconds, 72°C for 1 minute and final extension of 72 °C for 5 minutes. Agarose gel electrophoresis was used for detection of PCR amplification and visualized by UV fluorescence. Sequencing of PCR product was carried out by an automated sequencer where the same above primers were used. The 16S rRNA sequence was compared for similarity with the reference species contained in genomic database banks using the NCBI BLAST available at http://www.ncbi.nlm.nih.gov/nucleotide (Altschul et al. 1990). The phylogenetic analysis of the sequence with the closely related sequence of BLAST results was performed according to the neighbor joining method using MEGA version 6 (Tamura et al. 2013).

Statistical analysis

All experiments were conducted in triplicate and the results obtained from each set of data were expressed in terms of mean values (average) of triplicate and (±) standard deviations using a commercial spreadsheet package.

RESULTS AND DISCUSSION

Conventional methods currently used in wastewater treatment have various problems that still need to be overcome such as high cost, time consumption and dangerous by-products released to the environment (Puigagut et al. 2007). Isolation of microorganisms from unexploited environments may yield novel organisms with new, more interesting biotechnological applications that will have greater impact in the future. The antimicrobial activities of actinomycetes strains could be involved in microbial removal mechanisms in a wastewater treatment plant, which are a combination of physical, chemical, and biological factors. Actinomycetes can contribute to significantly reduce effluent concentrations of pathogenic microorganisms in wastewater (Bomo et al. 2003). In this study, the focus of the work was to isolate actinomycetes from the wastewater environment, which are thought to cause the foaming and bulking problems in wastewater (Davenport et al. 2000), and study their capabilities for removal of wastewater-associated bacteria. For this purpose, 58 actinomycetes isolates were isolated from the collected wastewater samples. Then, out of these isolates, 36 different isolates were selected for further studies.

Primary screening for antagonistic activity

Results of screening for antagonistic activity of the isolates by cross-streak method are depicted in Table 1 and Figure 1. Among 36 tested isolates, eight isolates (22.22%) had no antagonistic activity and 35 isolates (97.23%) were active against one or more of tested pathogenic bacteria. WD5 isolate showed the highest antagonistic activity against all tested bacteria (Figure 2). So, the WD5 isolate was selected for extraction of bioactive metabolites, screening of extract and identification by 16S rRNA and sequencing.

Table 1

Primary screening of actinomycetes for antagonistic activity by cross-streak method

Code of isolates Tested bacteria
 
Gram-positive bacteria
 
Gram-negative bacteria
 
S.a B.s E.f E.c P.a A.h 
WD1 ++ + − − − − 
WD2 − − − − − − 
WD3 ++ + + − − − − 
WD4 − − − − − 
WD5 ++ ++ 
WD6 − − − − 
WD7 − − − − − 
WD8 − − − − − − 
WD9 − − − − − − 
WD10 ++ ++ + − − − 
WD11 − − − − − ++ 
WD12 ++ + − − − 
WD13 − − 
WD14 − 
WD15 − − − − 
WD16 ++ ++ − 
WD17 − − − − 
WD18 − − − − − 
WD19 − − − − − 
WD20 − 
WD21 − − − − − − 
WD22 − − − ++ − 
WD23 − − − − − 
WD24 ++ − ++ − − 
WD25 − − − − − − 
WD26 ++ − − − − − 
WD27 − − 
WD28 − − −− ++ 
WD29 − − − − − − 
WD30 − −− − − − 
WD31 − − − −− 
WD32 − − − − 
WD33 − − − − − 
WD34 − − ++ 
WD35 − − − − − − 
WD36 − − − − − − 
Code of isolates Tested bacteria
 
Gram-positive bacteria
 
Gram-negative bacteria
 
S.a B.s E.f E.c P.a A.h 
WD1 ++ + − − − − 
WD2 − − − − − − 
WD3 ++ + + − − − − 
WD4 − − − − − 
WD5 ++ ++ 
WD6 − − − − 
WD7 − − − − − 
WD8 − − − − − − 
WD9 − − − − − − 
WD10 ++ ++ + − − − 
WD11 − − − − − ++ 
WD12 ++ + − − − 
WD13 − − 
WD14 − 
WD15 − − − − 
WD16 ++ ++ − 
WD17 − − − − 
WD18 − − − − − 
WD19 − − − − − 
WD20 − 
WD21 − − − − − − 
WD22 − − − ++ − 
WD23 − − − − − 
WD24 ++ − ++ − − 
WD25 − − − − − − 
WD26 ++ − − − − − 
WD27 − − 
WD28 − − −− ++ 
WD29 − − − − − − 
WD30 − −− − − − 
WD31 − − − −− 
WD32 − − − − 
WD33 − − − − − 
WD34 − − ++ 
WD35 − − − − − − 
WD36 − − − − − − 

(−) = no antagonistic activity (0% inhibition for inoculation line), (+) = weak activity (25% inhibition for inoculation line), (++ ) = moderate activity (50% inhibition for inoculation line), and (+++) = good activity (100% inhibition for inoculation line).

Gram-positive bacteria: Staphylococcus aureus MTCC 96 (S.a), Bacillus subtilis MTCC 736 (B.s), and Enterococcus faecalis ATCC 29212 (E.f).

Gram-negative bacteria: Escherichia coli MTCC 739 (E.c), Pseudomonas aeruginosa MTCC 2453 (P.a), and Aeromonas hydrophila ATCC 14715 (A.h).

Figure 1

Antagonistic activity of actinomycetes against tested bacteria.

Figure 1

Antagonistic activity of actinomycetes against tested bacteria.

Figure 2

Primary screening of isolate WD5 for antagonistic activity by cross-streak method. (a) The plate showing control without actinomycetes inoculation and (b) the plate showing inoculation with WD5 isolate (Escherichia coli MTCC 739 (E.c), Staphylococcus aureus MTCC 96 (S.a), Pseudomonas aeruginosa MTCC 2453 (P.a), Aeromonas hydrophila ATCC 14715 (A.h), Enterococcus faecalis ATCC 29212 (E.f), and Bacillus subtilis MTCC 736 (B.s)).

Figure 2

Primary screening of isolate WD5 for antagonistic activity by cross-streak method. (a) The plate showing control without actinomycetes inoculation and (b) the plate showing inoculation with WD5 isolate (Escherichia coli MTCC 739 (E.c), Staphylococcus aureus MTCC 96 (S.a), Pseudomonas aeruginosa MTCC 2453 (P.a), Aeromonas hydrophila ATCC 14715 (A.h), Enterococcus faecalis ATCC 29212 (E.f), and Bacillus subtilis MTCC 736 (B.s)).

Antagonistic activity of crude extract

The crude extract of WD5 isolate was subjected to secondary screening using the same tested bacteria. As clear from the results shown in Table 2 and Figure 3, crude extract of WD5 isolate caused a broad spectrum of antagonistic activity against both Gram-positive and Gram-negative tested bacteria. The extract recorded the highest antibacterial activity against Staphylococcus aureus MTCC 96 (23 mm) and lowest antibacterial activity against Pseudomonas aeruginosa MTCC 2453 (11 mm). So far, a number of reports are available in which antibacterial compounds have been extracted from actinomycetes and their activity has been studied. Mangamuri et al. (2012) found that Pseudonocardia (VUK-10) strain isolated from sediments showed broad-spectrum antimicrobial activity against bacteria and the diameter of zone of inhibition ranged from 9 to 15 mm. In another report, three actinomycetes isolates showed broad-spectrum activity against Gram-positive and Gram-negative bacteria with inhibition zone up to 22 mm. These isolates might produce more antibacterial metabolites that made them more effective against bacteria.

Table 2

Antagonistic activity of crude ethyl acetate extract of isolate WD5 expressed as inhibition zones using well diffusion method

Tested bacteria Diameter of inhibition zones (mm) 
Staphylococcus aureus MTCC 96 23 ± 1 
Bacillus subtilis MTCC 736 13 ± 1 
Enterococcus faecalis ATCC 29212 13 ± 1.73 
Escherichia coli MTCC 739 20 ± 2 
Pseudomonas aeruginosa MTCC 2453 11 ± 1 
Aeromonas hydrophila ATCC 14715 12 ± 1.73 
Tested bacteria Diameter of inhibition zones (mm) 
Staphylococcus aureus MTCC 96 23 ± 1 
Bacillus subtilis MTCC 736 13 ± 1 
Enterococcus faecalis ATCC 29212 13 ± 1.73 
Escherichia coli MTCC 739 20 ± 2 
Pseudomonas aeruginosa MTCC 2453 11 ± 1 
Aeromonas hydrophila ATCC 14715 12 ± 1.73 
Figure 3

Secondary screening for crude ethyl acetate extract of WD5 isolate by agar well diffusion method. The order of tested bacteria from left to right is Escherichia coli MTCC 739 (E.c), Staphylococcus aureus MTCC 96 (S.a), Pseudomonas aeruginosa MTCC 2453 (P.a), Aeromonas hydrophila ATCC 14715 (A.h), Enterococcus faecalis ATCC 29212 (E.f), and Bacillus subtilis MTCC 736 (B.s).

Figure 3

Secondary screening for crude ethyl acetate extract of WD5 isolate by agar well diffusion method. The order of tested bacteria from left to right is Escherichia coli MTCC 739 (E.c), Staphylococcus aureus MTCC 96 (S.a), Pseudomonas aeruginosa MTCC 2453 (P.a), Aeromonas hydrophila ATCC 14715 (A.h), Enterococcus faecalis ATCC 29212 (E.f), and Bacillus subtilis MTCC 736 (B.s).

Gas chromatography-mass spectrometry analysis

The GC-MS profile of the ethyl acetate extract of WD5 isolate and its constituents is shown in Figure 4 and Table 3. GC-MS analysis showed the presence of a total of seven compounds based on peak area, molecular weight, and molecular formula. The peak area was directly proportional to the quantity of compound present in the extract. By using available library data the seven compounds were determined as 2-methylbutyl acetate 42.98%, 3′,5′-dinitrobenzoic acid 49.62%, 1-octadecene 0.39%, tetradecane 0.98%, dodecane 0.83%, docosane 1.08% and methylamine,N,N-bis(N.-decyl) 4.12% at retention times (min) 6.58, 9.91, 18.09, 23.67, 28.59, 33.00, and 36.76 respectively. Many earlier studies by other researchers as revealed in Table 3 mentioned the antibacterial activity of all the above seven compounds that were extracted from WD5 isolate. These antibacterial metabolites which were extracted from WD5 isolate might cause the WD5 isolate to be effective against all Gram-positive and Gram-negative tested bacteria.

Table 3

Bioactive compounds identified in the ethyl acetate extract of WD5 isolate by GC-MS

Peak number Retention time (min) Name of compound Area % Molecular weight Molecular formula Other studies identifying antibacterial activity 
6.58 2-Methylbutyl acetate 42.98 130 C7H14O2 Bail et al. (2009)  
9.91 3′,5′-Dinitrobenzoic acid 49.62 416 C22H28N2O6 Khan et al. (2013) and Dhivya et al. (2015)  
18.09 1-Octadecene 0.39 252.28 C18H36 Mishra & Sree (2007)  
23.67 Tetradecane 0.98 198 C14H30 Girija et al. (2014)  
28.59 Dodecane 0.83 170 C12H26 Nandhini et al. (2015)  
33.00 Docosane 1.08 310 C22H46 Waage & Hedin (1985)  
36.76 Methylamine, N,N-bis(N.-decyl) 4.12 311 C21H45Kabara et al. (1972) and Cigáneková et al. (1989)  
Peak number Retention time (min) Name of compound Area % Molecular weight Molecular formula Other studies identifying antibacterial activity 
6.58 2-Methylbutyl acetate 42.98 130 C7H14O2 Bail et al. (2009)  
9.91 3′,5′-Dinitrobenzoic acid 49.62 416 C22H28N2O6 Khan et al. (2013) and Dhivya et al. (2015)  
18.09 1-Octadecene 0.39 252.28 C18H36 Mishra & Sree (2007)  
23.67 Tetradecane 0.98 198 C14H30 Girija et al. (2014)  
28.59 Dodecane 0.83 170 C12H26 Nandhini et al. (2015)  
33.00 Docosane 1.08 310 C22H46 Waage & Hedin (1985)  
36.76 Methylamine, N,N-bis(N.-decyl) 4.12 311 C21H45Kabara et al. (1972) and Cigáneková et al. (1989)  
Figure 4

Gas chromatography-mass spectrometry analysis of ethyl acetate extract of WD5 isolate.

Figure 4

Gas chromatography-mass spectrometry analysis of ethyl acetate extract of WD5 isolate.

16S rRNA sequencing and phylogenetic analysis

According to the phylogenetic comparison of the 16S rRNA sequence of WD5 isolate for similarity with the sequences of valid species in GenBank using BLAST analysis and MEGA 6 software, WD5 isolate was identified as Streptomyces sp. Phylogenetic tree analysis was constructed based on neighbor joining tree method and is illustrated in Figure 5. The database was deposited in NCBI GenBank under the accession number MK491056.

Figure 5

Phylogenetic tree of Streptomyces sp. WD5 (MK491056) constructed with neighbor joining method using MEGA 6 program.

Figure 5

Phylogenetic tree of Streptomyces sp. WD5 (MK491056) constructed with neighbor joining method using MEGA 6 program.

CONCLUSIONS

The study reported the antagonistic activities exhibited by different actinomycetes isolated from a wastewater treatment plant. Out of these antagonistic actinomycetes isolates, WD5 isolate showed a broad spectrum of antagonistic activity against both Gram-positive and Gram-negative bacteria. The GC-MS profile revealed the presence of seven antibacterial compounds in the crude ethyl acetate extract of WD5. The 16S rRNA sequence of WD5 was deposited in GenBank under the accession number MK491056 and was confirmed as Streptomyces sp. Bioactive compounds which are naturally produced by microorganisms help them in their microbial war. Further, the optimization of the antagonistic activity of this isolate and purification of its important bioactive compounds can be further studied for applications as a biocontrol agent against wastewater-associated bacteria. In addition to the influence of abiotic factors in removal of microorganisms from wastewater, the antagonistic activity of actinomycetes can contribute significantly to microbial inactivation and elimination.

ACKNOWLEDGEMENTS

The authors would like to thank the National Water Research Center and the Central Laboratory Environmental Quality Monitoring staff for their support and cooperation to accomplish this work.

REFERENCES

REFERENCES
Al-Tameme
H. J.
,
Hameed
I. H.
,
Idan
S. A.
&
Hadi
M. Y.
2015
Biochemical analysis of Origanum vulgare seeds by Fourier-transform infrared (FT-IR) spectroscopy and gas chromatography-mass spectrometry (GC-MS)
.
Journal of Pharmacognosy and Phytotherapy
7
(
9
),
221
237
.
Altschul
S. F.
,
Gish
W.
,
Miller
W.
,
Myers
E. W.
&
Lipman
D. J.
1990
Basic local alignment search tool
.
Journal of Molecular Biology
215
(
3
),
403
410
.
Arnone
R. D.
&
Walling
J. P.
2007
Waterborne pathogens in urban watersheds
.
Journal of Water and Health
5
(
1
),
149
162
.
Bail
S.
,
Buchbauer
G.
,
Jirovetz
L.
,
Denkova
Z.
,
Slavchev
A.
,
Stoyanova
A.
,
Schmidt
E.
&
Geissler
M.
2009
Antimicrobial activities of roman chamomile oil from France and its main compounds
.
Journal of Essential Oil Research
21
(
3
),
283
286
.
Bérdy
J.
2005
Bioactive microbial metabolites
.
The Journal of Antibiotics
58
(
1
),
1
.
Bomo
A.-M.
,
Husby
A.
,
Stevik
T. K.
&
Hanssen
J. F.
2003
Removal of fish pathogenic bacteria in biological sand filters
.
Water Research
37
(
11
),
2618
2626
.
Cheng
H.-W. A.
,
Lucy
F. E.
,
Broaders
M. A.
,
Mastitsky
S. E.
,
Chen
C.-H.
&
Murray
A.
2012
Municipal wastewater treatment plants as pathogen removal systems and as a contamination source of noroviruses and Enterococcus faecalis
.
Journal of Water and Health
10
(
3
),
380
389
.
Cigáneková
V.
,
Kallová
J.
,
Devínsky
F.
&
Lacko
I.
1989
Effect of N,N′-bis(alkyldimethyl)-α,ω-alkanediammonium dibromides on bacteria of the genus Clostridium
.
Folia Microbiologica
34
(
3
),
202
208
.
Davenport
R. J.
,
Curtis
T. P.
,
Goodfellow
M.
,
Stainsby
F. M.
&
Bingley
M.
2000
Quantitative use of fluorescent in situ hybridization to examine relationships between mycolic acid-containing actinomycetes and foaming in activated sludge plants
.
Applied and Environmental Microbiology
66
(
3
),
1158
1166
.
Dhivya
C.
,
Vandarkuzhali
S. A. A.
&
Radha
N.
2015
Antimicrobial activities of nanostructured polyanilines doped with aromatic nitro compounds
.
Arabian Journal of Chemistry
. https://doi.org/10.1016/j.arabjc.2015.12.005.
Gerba
C. P.
&
Smith
J. E.
2005
Sources of pathogenic microorganisms and their fate during land application of wastes
.
Journal of Environmental Quality
34
(
1
),
42
48
.
Girija
S.
,
Duraipandiyan
V.
,
Kuppusamy
P. S.
,
Gajendran
H.
&
Rajagopal
R.
2014
Chromatographic characterization and GC-MS evaluation of the bioactive constituents with antimicrobial potential from the pigmented ink of Loligo duvauceli
.
International Scholarly Research Notices
2014
. http://dx.doi.org/10.1155/2014/820745.
Hacène
H.
,
Daoudi-Hamdad
F.
,
Bhatnagar
T.
,
Baratti
J.
&
Lefebvre
G.
2000
H107, a new aminoglycoside anti-Pseudomonas antibiotic produced by a new strain of Spirillospora
.
Microbios
102
(
402
),
69
77
.
Hibbing
M. E.
,
Fuqua
C.
,
Parsek
M. R.
&
Peterson
S. B.
2010
Bacterial competition: surviving and thriving in the microbial jungle
.
Nature Reviews Microbiology
8
(
1
),
15
.
Hirsch
C.
&
Christensen
D.
1983
Novel method for selective isolation of actinomycetes
.
Applied and Environmental Microbiology
46
(
4
),
925
929
.
Jack
R. W.
,
Tagg
J. R.
&
Ray
B.
1995
Bacteriocins of gram-positive bacteria
.
Microbiology and Molecular Biology Reviews
59
(
2
),
171
200
.
Kabara
J. J.
,
Conley
A. J.
&
Truant
J. P.
1972
Relationship of chemical structure and antimicrobial activity of alkyl amides and amines
.
Antimicrobial Agents and Chemotherapy
2
(
6
),
492
498
.
Liu
C.-M.
,
Westley
J. W.
,
Hermann
T.
,
Prosser
B. L. T.
,
Palleroni
N.
,
Evans
R.
&
Miller
P.
1986
Novel polyether antibiotics X-14873a, G and H produced by a Streptomyces: taxonomy of the producing culture, fermentation, biological and ionophorous properties of the antibiotics
.
The Journal of Antibiotics
39
(
12
),
1712
1718
.
Mangamuri
U. K.
,
Muvva
V.
,
Poda
S.
&
Kamma
S.
2012
Isolation, identification and molecular characterization of rare actinomycetes from mangrove ecosystem of Nizampatnam
.
Malaysian Journal of Microbiology
8
(
2
),
83
91
.
Nandhini
S. U.
,
Sangareshwari
S.
&
Lata
K.
2015
Gas chromatography-mass spectrometry analysis of bioactive constituents from the marine Streptomyces
.
Asian Journal of Pharmaceutical and Clinical Research
8
(
2
),
244
246
.
Olsen
J. S.
,
Aarskaug
T.
,
Thrane
I.
,
Pourcel
C.
,
Ask
E.
,
Johansen
G.
,
Waagen
V.
&
Blatny
J. M.
2010
Alternative routes for dissemination of Legionella pneumophila causing three outbreaks in Norway
.
Environmental Science & Technology
44
(
22
),
8712
8717
.
Puigagut
J.
,
Villaseñor
J.
,
Salas
J. J.
,
Bécares
E.
&
García
J.
2007
Subsurface-flow constructed wetlands in Spain for the sanitation of small communities: a comparative study
.
Ecological Engineering
30
(
4
),
312
319
.
Reynolds
J.
&
Barrett
M.
2003
A review of the effects of sewer leakage on groundwater quality
.
Water and Environment Journal
17
(
1
),
34
39
.
Sadeghi
G.
,
Schijven
J. F.
,
Behrends
T.
,
Hassanizadeh
S. M.
,
Gerritse
J.
&
Kleingeld
P. J.
2011
Systematic study of effects of pH and ionic strength on attachment of phage PRD1
.
Groundwater
49
(
1
),
12
19
.
Seidel
M.
,
Jurzik
L.
,
Brettar
I.
,
Höfle
M. G.
&
Griebler
C.
2016
Microbial and viral pathogens in freshwater: current research aspects studied in Germany
.
Environmental Earth Sciences
75
(
20
),
1384
.
Sinton
L. W.
,
Hall
C. H.
,
Lynch
P. A.
&
Davies-Colley
R. J.
2002
Sunlight inactivation of fecal indicator bacteria and bacteriophages from waste stabilization pond effluent in fresh and saline waters
.
Applied and Environmental Microbiology
68
(
3
),
1122
1131
.
Sonune
A.
&
Ghate
R.
2004
Developments in wastewater treatment methods
.
Desalination
167
,
55
63
.
Tamura
K.
,
Stecher
G.
,
Peterson
D.
,
Filipski
A.
&
Kumar
S.
2013
MEGA6: molecular evolutionary genetics analysis version 6.0
.
Molecular Biology and Evolution
30
(
12
),
2725
2729
.
Valli
S.
,
Suvathi
S. S.
,
Aysha
O.
,
Nirmala
P.
,
Vinoth
K. P.
&
Reena
A.
2012
Antimicrobial potential of Actinomycetes species isolated from marine environment
.
Asian Pacific Journal of Tropical Biomedicine
2
(
6
),
469
473
.
Vital
M.
,
Füchslin
H. P.
,
Hammes
F.
&
Egli
T.
2007
Growth of Vibrio cholerae O1 Ogawa Eltor in freshwater
.
Microbiology
153
(
7
),
1993
2001
.