Abstract

The rapid overcompensatory growth that appears when cyanobacteria are supplied with adequate resources after a period of resource deprivation might contribute to the occurrence of cyanobacterial blooms. We investigated the changing characteristics of overcompensatory growth and serine/threonine kinase (STK) genes expression of cyanobacterium Microcystis aeruginosa in response to light limitation. The results showed M. aeruginosa exhibited overcompensatory growth for 2 days after light recovery, during which the increase in growth was inversely related to light intensity. Expression of STK genes, such as spkD, was upregulated significantly at 0.5–4 h after light recovery (P < 0.05). To investigate the function of STK genes in the overcompensatory growth, M. aeruginosa spkD was heterologously expressed in Synechocystis. Transgenic Synechocystis exhibited greater and longer overcompensatory growth than wild-type Synechocystis after light recovery. Relative expression levels of STK genes in transgenic Synechocystis were significantly higher than those in wild-type Synechocystis at 24 h of light recovery (P < 0.05). Heterologous expression of Microcystis spkD might stimulate overcompensatory growth of Synechocystis by affecting its STK gene expression.

HIGHLIGHTS

  • Light limitation induced overcompensatory growth of Microcystis.

  • Light limitation affected expression of most STK genes of Microcystis.

  • Heterologous expression of MicrocystisspkD enhanced and prolonged light-limitation-induced overcompensatory growth of transgenic Synechocystis.

  • Heterologous expression of MicrocystisspkD stimulated relative expression levels of STK genes in transgenic Synechocystis.

INTRODUCTION

Microcystis is a globally distributed bloom-forming genus of cyanobacterium (Haande et al. 2007; Shen & Song 2007). Frequent Microcystis blooms in natural waters are related to environmental factors, such as nutrients, light, and temperature (Huisman et al. 2018), and to the strong adaptability of this genus to adversity (Los et al. 2010; Zhou et al. 2011). Another cofactor in determining Microcystis blooms is that Microcystis is not very palatable to many zooplankters (DeMott et al. 2001; Wang et al. 2010; Reichwaldt et al. 2013), so that Microcystis blooms are rarely kept in check via herbivory/predation. Overcompensatory growth is a phase of accelerated growth that occurs upon availability of adequate resources following a period of resource deprivation (Ali et al. 2003). Microcystis shows marked overcompensatory growth after exposure to environmental stress, such as high temperature (Han et al. 2015), and high concentration of lead(II) (Bi et al. 2013). Accelerated proliferation during overcompensatory growth might be an endogenous factor responsible for transient bursts of cyanobacterial biomass when water blooms break out. Most studies of Microcystis overcompensatory growth are limited to a description of the phenomenon and changes in physiological and biochemical indexes under environmental stress (Bi et al. 2013; Han et al. 2015) and the molecular mechanism underlying overcompensatory growth of Microcystis is unclear. Clarifying this mechanism can facilitate the early detection and control of cyanobacterial blooms.

Signal transduction systems enable prokaryotes to acclimate to changing environments by precisely regulating gene expression controlling division and differentiation (Los et al. 2010). Signal transduction in prokaryotes is perceived to occur primarily via the two-component signaling system involving histidine kinases and cognate response regulators (Agarwal et al. 2011). As an alternative regulatory pathway, eukaryote-type serine/threonine kinases (STKs) have been found to be necessary for cellular functions of prokaryotes such as growth, division, and differentiation (Rajagopal et al. 2003; Pereira et al. 2011). STKs, a series of ATP-dependent protein kinases, could phosphorylate other proteins and catalyze their own phosphorylation by transferring gamma-phosphoric acid from ATP serine (Ser) and threonine (Thr) to residues of target proteins (Pereira et al. 2011). Previous studies of cyanobacterial STKs mainly focused on the functions of STKs in cell motility (Kamei et al. 2001; Kamei et al. 2003), stress tolerance (Liang et al. 2011; Zorina et al. 2014), and morphogenesis (Panichkin et al. 2006) in model cyanobacteria. However, the role of STKs in the overcompensatory growth of cyanobacteria has not been reported.

We characterized the overcompensatory growth of Microcystis after light-limitation stress and investigated the expression of key STK genes (e.g. spkD) during the subsequent overcompensatory growth. Synechocystis sp. PCC6803 is a cyanobacterial strain bearing the ability to be transformed naturally (Williams 1988), and its entire genome nucleotide sequence has been determined (Kaneko et al. 1996). We heterologously expressed Microcystis spkD in Synechocystis to analyze its role in light-limitation-induced overcompensatory growth of cyanobacteria.

METHODS

Strains and growth conditions

The cyanobacteria Microcystis aeruginosa PCC7806 (hereafter M. aeruginosa) and Synechocystis sp. PCC6803 (hereafter Synechocystis) were obtained from the Freshwater Algae Culture Collection of the Institute of Hydrobiology, Chinese Academy of Sciences. M. aeruginosa was grown in BG-11 medium (Rippka et al. 1979) under a 12 h light/12 h dark photoperiod with a light density of 32 μmol/m2/s at 25 ± 1 °C. BG-11 medium contains (g/L): NaNO3 (1.5), K2HPO4 (0.04), MgSO4·7H2O (0.075), CaCl2·2H2O (0.036), citric acid (0.006), iron(III) ammonium citrate (0.006), Na2-EDTA (0.001), and Na2CO (0.02), and 1 mL of trace elements solution (mg/L): H3BO3 (61), MnSO4·H2O (169), ZnSO4·7H2O (287), CuSO4·5H2O (2.5), and (NH4)6Mo7O24·4H2O (12.5), pH 6.8 (Rippka et al. 1979). Synechocystis was cultivated in BG-11 medium (5 mM glucose) at 30 °C. For solid BG-11 medium, 1.5% (w/v) Difco Bacto-agar (Becton Dickinson, Sparks, MD, USA), 0.3% (w/v) sodium thiosulfate, and 10 mM TES (2- {[2-hydroxy-1,1-bis (hydroxymethyl) ethyl] amino} ethanesulfonic acid, pH 8.2) were added.

Analysis of overcompensatory growth performance of M. aeruginosa after light-limitation stress

M. aeruginosa grown to the exponential growth phase was reinoculated into 250-mL flask with 100 mL BG-11 medium and cultured for 24 h before the subsequent light-limitation experiment. M. aeruginosa were cultured at seven different light intensities (0, 1, 2, 4, 8, 16, and 32 μmol/m2/s) under a 12 h light/12 h dark cycle for 4 days, and then collected. Collected M. aeruginosa were centrifuged (6,000 × g for 10 min at room temperature) and then added to 250-mL flasks containing 100 mL BG-11 medium to a cell density of 5.49 × 109ind/L and cultured at normal light intensity of 32 μmol/m2/s for 6 days. All treatments had triplicate flasks. M. aeruginosa cultured at continuous light density of 32 μmol/m2/s served as controls. In the light recovery stage, the growth of M. aeruginosa was estimated each day from the optical density at 680 nm (OD680) using a spectrophotometer. A standard curve relating M. aeruginosa cell density to OD680 was established using serial dilutions of culture. Total RNA for subsequent real-time quantitative PCR (RT-qPCR) analysis of M. aeruginosa was isolated from cells cultured at continuous light density of 32 μmol/m2/s or darkness (0 μmol/m2/s) after light recovery for 0, 0.5, 4, 24, and 48 h.

Generation of STK heterologous recombinant plasmids containing spkD from M. aeruginosa PCC7806

For heterologous expression of spkD in Synechocystis, the 1.1-kb spkD gene (GenBank: AM778950) was amplified from M. aeruginosa PCC7806 using primers SpkD-fpsbA2P-F and SpkD-EcoRI-R (Table 1). The upstream promoter region (0.5-kb fragment) of Synechocystis psbA2 was amplified by PCR from genomic DNA. To fuse the psbA2 promoter to spkD, the psbA2 promoter was amplified using psbA2-Promoter-Sal-F and psbA2-Promoter-R, and the 1.0-kb fragment of Synechocystis genomic DNA encoding the psbA2 open reading frame (ORF) was amplified by PCR using primers psbA2-SacII-F and psbA2-SacI-R to create the downstream region of the homologous recombinant vector. The downstream fragment was cloned into the SacII and SacI sites of pBluescript SK + T1T2 to form p5ST1T2psbA2. A kanamycin resistance cassette carrying npt was then cloned into the single BamHI site of p5ST1T2psbA2 to form p5ST1T2psbA2npt. The fused psbA2 promoter and spkD fragments were cloned into the SalI and EcoRI sites of p5ST1T2psbA2npt to form p5SspkD (Figure 1) (Chen et al. 2017).

Table 1

Primer sequences used in generation of STK heterologous recombination plasmidsa

PrimerSequence (5′—3′)
psbA2-Promoter-SalI-F AATGTCGACTGCCCAGATGCAGGCCTTC 
psbA2-Promoter-R TTGGTTATAATTCCTTATGT 
spkD-fpsbA2P-F TAAGGAATTATAACCAAATGACGGATTTAATTCTAC 
spkD-EcoRI-R CGCGAATTCTCAAAATGAGAATTGCTG 
psbA2ORF-SacII-F CTTCCGCGGATGACAACGACTCTCCAAC 
psbA2ORF-SacI-R AGTGAGCTCTTAACCGTTGACAGCAGG 
PrimerSequence (5′—3′)
psbA2-Promoter-SalI-F AATGTCGACTGCCCAGATGCAGGCCTTC 
psbA2-Promoter-R TTGGTTATAATTCCTTATGT 
spkD-fpsbA2P-F TAAGGAATTATAACCAAATGACGGATTTAATTCTAC 
spkD-EcoRI-R CGCGAATTCTCAAAATGAGAATTGCTG 
psbA2ORF-SacII-F CTTCCGCGGATGACAACGACTCTCCAAC 
psbA2ORF-SacI-R AGTGAGCTCTTAACCGTTGACAGCAGG 

aItalicized, underlined text indicates restriction enzyme sites.

Figure 1

Structure of homologous recombinant vector harboring spkD gene of M. aeruginosa PCC7806 in pBluescript II SK (+). The psbA2 promoter (PpsbA2), consisting of a 0.5-kb fragment upstream (UP) of psbA2, the kanamycin resistance cassette (Kan), a 1.0-kb fragment downstream of psbA2 (psbA2 ORF), and the Escherichia coli 5ST1T2 terminator were cloned into plasmids. Amp: ampicillin resistance cassette.

Figure 1

Structure of homologous recombinant vector harboring spkD gene of M. aeruginosa PCC7806 in pBluescript II SK (+). The psbA2 promoter (PpsbA2), consisting of a 0.5-kb fragment upstream (UP) of psbA2, the kanamycin resistance cassette (Kan), a 1.0-kb fragment downstream of psbA2 (psbA2 ORF), and the Escherichia coli 5ST1T2 terminator were cloned into plasmids. Amp: ampicillin resistance cassette.

Figure 2

Effects of light limitation on overcompensatory growth of M. aeruginosa. Values sharing the same letters or no letters are not significantly different (P > 0.05), whereas those with different letters are significantly different (P < 0.05).

Figure 2

Effects of light limitation on overcompensatory growth of M. aeruginosa. Values sharing the same letters or no letters are not significantly different (P > 0.05), whereas those with different letters are significantly different (P < 0.05).

Transformation of Synechocystis

The Synechocystis strain was transformed as described by Chen et al. (2014). Synechocystis was grown in liquid BG-11 medium until the OD730 reached 0.6. Cells were then harvested by centrifugation (6,000 × g for 10 min at room temperature) and resuspended in fresh BG-11 to a density of OD730 = 4.8. Plasmid DNA was added to 500 μL of cell suspension and gently mixed; cells were incubated at 30 °C under low light for 6 h and then spread on BG-11 agar plates containing 50 μg/mL kanamycin (Dingguo Company, Beijing, China). Transformants were isolated after about 10 days of incubation and subcultured on BG-11 agar plates containing 100 μg/mL kanamycin. The transformants were then grown in liquid culture for further analysis.

Analysis of overcompensatory growth performance of Synechocystis after light-limitation stress

Synechocystis (wild-type and transgenic) was cultured at three different light intensities (0, 8, and 32 μmol/m2/s) under a 12 h light/12 h dark cycle for 4 days. After brief centrifugation (6,000 × g for 10 min at room temperature), Synechocystis was added to BG-11 medium to a cell density of 4.58 × 1010ind/L and cultured at normal light intensity of 32 μmol/m2/s for 6 days. All treatments had triplicate flasks, and Synechocystis cultured continuously under 32 μmol/m2/s served as controls. In the light recovery stage, growth of Synechocystis was estimated each day from the OD730 using a spectrophotometer. A standard curve relating Synechocystis cell density to OD730 was established using serial dilutions of culture. Total RNA for subsequent RT-qPCR analysis was isolated from Synechocystis at 0, 2, 6, 24, and 144 h.

Calculation of specific growth rate

The specific growth rate was calculated using the following formula: μ = (lnNt − lnNt−1)/Δt, where Nt−1 is the cell density at the beginning of the time interval, Nt is the cell density at the end of the time interval, and Δt is the length of the time interval which equals 1 day.

RNA isolation and cDNA synthesis

Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer's instructions. First-strand cDNA was synthesized using Moloney Murine Leukemia Virus (M-MLV) reverse transcriptase and modified oligo (dT) following the manufacturer's instructions (TaKaRa, Dalian, China).

RT-qPCR analysis

RT-qPCR examination of STK expression was carried out using a Bio-Rad iQ5 with reactions prepared following the manufacturer's instructions. Primers used for RT-qPCR are listed in Table 2. Each PCR was repeated four times in a total volume of 20 μL containing 2 × SYBR Green I PCR Master Mix (TaKaRa), 100 nM of each primer, and 1 μL diluted (1:20) template cDNA. Reactions were carried out in 96-well optical-grade PCR plates with optical-grade membrane (TaKaRa). The amplification program was as follows: initial denaturing of 1 min at 95 °C, followed by 42 cycles of 10 s at 95 °C, 30 s at 60 °C, and 30 s at 72 °C ; an additional cycle of 10 s at 95 °C, 30 s at 58 °C, and 5 min at 72 °C ; and 10 s at 95 °C for melting curve analysis. Data were analyzed with Bio-Rad iQ5 software. Relative expression of STKs was calculated using the relative 2ΔΔCt method (Chen et al. 2012).

Table 2

The primers of different STKs used in qRT-PCR

Gene nameSequence (5′—3′)
MAE_RS26565 (putative spkAF  CCTCCTTTGGCAGTTGGT 
R  CCGTCGGCAGACTTGATA 
MAE_RS23275(putative spkBF  GCCACTTCCTCCGTTTCT 
R  GCTGCTGCGGGCTTTACT 
MAE_RS08890 (putative spkCF  GCAGGAGTGGATTGACGG 
R  AGGATCGAGTAAGGTGGC 
AM778950 IPF_5717(putative spkDF  AAGAAACTATGGGAACGG 
R  CTTGAGTAGGAGCGGGAG 
MAE_RS06365 (putative spkFF  AGATGAGGGTGAGGGTAA 
R  AAACCTTCGCTAATGCTG 
ropC1 (reference gene of M. aeruginosaF  CCTCAGCGAAGATCAATGGT 
R  CCGTTTTTGCCCCTTACTTT 
sll1575 (spkAF  TGTAGCGGATGCTGGAC 
R  ACTCAACACGGATATGGAA 
slr1697 (spkBF  CAAATTGATTCGGTCCTCT 
R  TTCCCAGTCCATCTCCC 
slr0599 (spkCF  GCCACCAAGGTTTACACTC 
R  CCGCCAATCACTAGCAGTA 
mpb (reference gene of Synechocystis sp. PCC6803) F  GTGAGGACAGTGCCACAGAA 
R  GGCAGGAAAAAGACCAACCT 
Gene nameSequence (5′—3′)
MAE_RS26565 (putative spkAF  CCTCCTTTGGCAGTTGGT 
R  CCGTCGGCAGACTTGATA 
MAE_RS23275(putative spkBF  GCCACTTCCTCCGTTTCT 
R  GCTGCTGCGGGCTTTACT 
MAE_RS08890 (putative spkCF  GCAGGAGTGGATTGACGG 
R  AGGATCGAGTAAGGTGGC 
AM778950 IPF_5717(putative spkDF  AAGAAACTATGGGAACGG 
R  CTTGAGTAGGAGCGGGAG 
MAE_RS06365 (putative spkFF  AGATGAGGGTGAGGGTAA 
R  AAACCTTCGCTAATGCTG 
ropC1 (reference gene of M. aeruginosaF  CCTCAGCGAAGATCAATGGT 
R  CCGTTTTTGCCCCTTACTTT 
sll1575 (spkAF  TGTAGCGGATGCTGGAC 
R  ACTCAACACGGATATGGAA 
slr1697 (spkBF  CAAATTGATTCGGTCCTCT 
R  TTCCCAGTCCATCTCCC 
slr0599 (spkCF  GCCACCAAGGTTTACACTC 
R  CCGCCAATCACTAGCAGTA 
mpb (reference gene of Synechocystis sp. PCC6803) F  GTGAGGACAGTGCCACAGAA 
R  GGCAGGAAAAAGACCAACCT 

Statistical analysis

Data was expressed as means ± standard deviation (n = 3). Significant differences (P < 0.05) between treatments under different light limitations or at different times after restoration from light limitation were analyzed by one-way analysis of variance (ANOVA) followed by the least significant difference multiple-range test using SPSS 10.0. T-test was used to test significant difference between wild-type and transgenic Synechocystis.

Characteristics of overcompensatory growth of M. aeruginosa

We established a standard curve relating M. aeruginosa cell density to OD680 (y = 24.67x + 0.108, r2 = 0.993, n = 7). After the end of light limitation, Microcystis exhibited overcompensatory growth for 2 days, during which the increase in growth was inversely related to light intensity (Figure 2). At day 1 of light recovery, specific growth rate of M. aeruginosa was higher for cells previously grown at lower light intensities. Compared to the control group, specific growth rates in light-limited groups (except 16 μmol/m2/s) were significantly greater (P < 0.05). At day 2 of light recovery, no significant differences in specific growth rates were detected between the control group and groups exposed to limited light of 16 and 8 μmol/m2/s. However, compared to the control group, specific growth rates in light-limited groups exposed to 4, 2, 1, and 0 μmol/m2/s were significantly greater (P < 0.05). Insignificant differences were observed among the specific growth rates of M. aeruginosa exposed to the seven light intensities (P > 0.05) when light recovery exceeded 2 days.

Gene expression of M. aeruginosa STKs after light-limitation stress

No significant changes were observed between relative expression values (in darkness to in continuous light of 32 μmol/m2/s) of spkA under light-limitation stress (Figure 3). However, relative expression values of the other four STK genes first increased significantly, peaked at 0.5 h, and then decreased. Compared to the control group cultured under continuous light of 32 μmol/m2/s, putative spkF (GenBank: AM778936), spkD (GenBank: AM778938), spkB (GenBank: AM778950), and spkC (GenBank: AM778896) in darkness were upregulated 12.44, 5.62, 4.86, and 2.61 times, respectively, at 0.5 h.

Figure 3

Changes in the relative expression of STK genes in M. aeruginosa after light-limitation stress. Values sharing the same letters or no letters are not significantly different (P > 0.05), whereas those with different letters are significantly different (P < 0.05).

Figure 3

Changes in the relative expression of STK genes in M. aeruginosa after light-limitation stress. Values sharing the same letters or no letters are not significantly different (P > 0.05), whereas those with different letters are significantly different (P < 0.05).

Characteristics of overcompensatory growth of transgenic Synechocystis

PCR analysis of wild-type and transformed Synechocystis is shown in Figure 4, and the transformant lines were the expected transgenic Synechocystis. We established standard curves relating wild-type Synechocystis cell density to OD730 (y = 3.420x + 0.493, r2 = 0.996, n = 6), and transgenic Synechocystis cell density to OD730 (y = 3.380x + 0.538, r2 = 0.993, n = 6), respectively. Compared to the control group cultured under continuous light of 32 μmol/m2/s (Figure 5), the specific growth rates of wild-type Synechocystis in light-limited groups increased during the first 2 days of light recovery, suggesting that overcompensatory growth in wild-type Synechocystis lasted for 2 days. However, compared to the control group, specific growth rates of transgenic Synechocystis in light-limited groups increased during the first 2 days and the last 2 days of light recovery. Overcompensatory growth lasted longer in transgenic Synechocystis than in wild-type Synechocystis. After 4 days of light recovery, specific growth rates of transgenic Synechocystis were all significantly higher than those of wild-type Synechocystis (P < 0.05). Transgenic Synechocystis exhibited greater overcompensatory growth than wild-type Synechocystis, and this growth lasted longer.

Figure 4

PCR analysis of wild-type Synechocystis and spkD transformant. M, Generay Normal Run 250 bp-II ladder; lane 1, PCR analysis of wild-type Synechocystis using primers Promoter-SalI-F and spkD-EcoRI-R; lane 2, PCR analysis of spkD transformant using primers Promoter-SalI-F and spkD-EcoRI-R; lane 3, PCR analysis of wild-type Synechocystis using primers spkD-fpsbA2P-F and T1T2-R; lane 4, PCR analysis of the wild-type and spkD transformant using primers spkD-fpsbA2P-F and T1T2-R; lane 5, PCR analysis of wild-type Synechocystis using primers Promoter-SalI-F and T1T2-R; lane 6, PCR analysis of the wild-type and spkD transformant using primers Promoter-SalI-F and psbA2ORF-R.

Figure 4

PCR analysis of wild-type Synechocystis and spkD transformant. M, Generay Normal Run 250 bp-II ladder; lane 1, PCR analysis of wild-type Synechocystis using primers Promoter-SalI-F and spkD-EcoRI-R; lane 2, PCR analysis of spkD transformant using primers Promoter-SalI-F and spkD-EcoRI-R; lane 3, PCR analysis of wild-type Synechocystis using primers spkD-fpsbA2P-F and T1T2-R; lane 4, PCR analysis of the wild-type and spkD transformant using primers spkD-fpsbA2P-F and T1T2-R; lane 5, PCR analysis of wild-type Synechocystis using primers Promoter-SalI-F and T1T2-R; lane 6, PCR analysis of the wild-type and spkD transformant using primers Promoter-SalI-F and psbA2ORF-R.

Figure 5

Effects of light limitation on overcompensatory growth of wild-type and transgenic Synechocystis. The asterisk indicates significant difference between wild-type (WT) and transgenic (T) Synechocystis (P < 0.05). Values sharing the same letters in uppercase are not significantly different between wild-type Synechocystis under different light limitations (P > 0.05), whereas those with different letters in uppercase are significantly different between wild-type Synechocystis under different light limitations (P < 0.05). Values sharing the same letters or no letters in lowercase are not significantly different between transgenic Synechocystis under different light limitations (P > 0.05), whereas those with different letters in lowercase are significantly different between transgenic Synechocystis under different light limitations (P < 0.05).

Figure 5

Effects of light limitation on overcompensatory growth of wild-type and transgenic Synechocystis. The asterisk indicates significant difference between wild-type (WT) and transgenic (T) Synechocystis (P < 0.05). Values sharing the same letters in uppercase are not significantly different between wild-type Synechocystis under different light limitations (P > 0.05), whereas those with different letters in uppercase are significantly different between wild-type Synechocystis under different light limitations (P < 0.05). Values sharing the same letters or no letters in lowercase are not significantly different between transgenic Synechocystis under different light limitations (P > 0.05), whereas those with different letters in lowercase are significantly different between transgenic Synechocystis under different light limitations (P < 0.05).

Effects of heterologous spkD on gene expression of STKs in Synechocystis after light-limitation stress

During the light recovery stage, expression levels of most STK genes in both wild-type and transgenic Synechocystis previously exposed to limited light (0 and 8 μmol/m2/s) were higher than those in cells exposed to normal light (32 μmol/m2/s) (Figure 6). At 2 h and 6 h of light recovery, transgenic Synechocystis exhibited lower relative STK gene expression than wild-type Synechocystis. Relative STK gene expression levels were significantly higher in transgenic Synechocystis than in wild-type Synechocystis at 24 h of light recovery (P < 0.05). After 24 h of light recovery, relative expression of STK genes (except spkA) in transgenic Synechocystis decreased significantly (P < 0.05) and the difference in relative expression between wild-type and transgenic Synechocystis decreased. Except for spkA and spkF in wild-type Synechocystis, relative expression levels of all STK genes in both wild-type and transgenic Synechocystis exposed to 0 μmol/m2/s light were significantly higher than those in cells exposed to 8 μmol/m2/s light at 144 h of light recovery (P < 0.05).

Figure 6

Changes in the relative expression of STK genes in wild-type and transgenic Synechocystis after light-limitation stress (0 and 8 μmol/m2/s). STK gene expression under normal light conditions (32 μmol/m2/s) was used as control. μ represents μmol/m2/s.

Figure 6

Changes in the relative expression of STK genes in wild-type and transgenic Synechocystis after light-limitation stress (0 and 8 μmol/m2/s). STK gene expression under normal light conditions (32 μmol/m2/s) was used as control. μ represents μmol/m2/s.

At 2 h after light recovery, except for spkB after exposure to normal light (32 μmol/m2/s), expression levels of all STK genes in transgenic Synechocystis were lower than those in wild-type Synechocystis (Figure 7). At 6 h of light recovery, STK gene expression was triggered to a greater extent in transgenic Synechocystis than in wild-type Synechocystis, and expression levels of all STK genes in transgenic Synechocystis were much higher than those in wild-type. Except for spkE, relative STK gene expression levels decreased with light intensity in the following order: 32 μmol/m2/s > 0 μmol/m2/s > 8 μmol/m2/s. After 6 h of light recovery, except for spkA, expression levels of all STK genes in transgenic Synechocystis were lower than those in wild-type Synechocystis.

Figure 7

Changes in the relative expression of STK genes in transgenic Synechocystis after light-limitation stress (0, 8, and 32 μmol/m2/s). STK gene expression of wild-type Synechocystis was used as control.

Figure 7

Changes in the relative expression of STK genes in transgenic Synechocystis after light-limitation stress (0, 8, and 32 μmol/m2/s). STK gene expression of wild-type Synechocystis was used as control.

DISCUSSION

Compensatory growth has been studied extensively in a variety of animals and plants (Oesterheld & McNaughton 1991) and is considered an adaptive response of organisms to wide fluctuations in environmental factors (Turano et al. 2007). Compensatory growth in fish was classified into three types depending on the degree of recovery following relief from resource restriction: overcompensation, leading to fish growing larger than control fish; complete compensation, leading to fish achieving the same body mass as control fish; and partial compensation, leading to fish exhibiting accelerated growth, but not achieving the mass of control fish (Tian & Qin 2003). Overcompensatory growth was induced in microalgae by subjecting them to periods of resource restriction, such as high-temperature stress (Han et al. 2015), and darkness stress (Cai et al. 2009). Light is a key environmental factor influencing microalgal growth and proliferation. The photoautotroph Microcystis relies heavily on light, which acts as the main energy source for its growth. In this study, overcompensatory growth occurred immediately upon light recovery. The amount and duration of compensatory growth are dependent on the type and level of stress (Oesterheld & McNaughton 1991). Overcompensatory growth, might be one of the adaptation strategies used by Microcystis for light intensity variation. Based on overcompensatory growth in response to light limitation, Microcystis might proliferate exceptionally fast when subjected to continuous rainy days with low light intensities followed by normal clear weather. Mass growths of Microcystis leading to the production of blooms can threaten ecosystem functioning and degrade water quality for recreation, drinking water, and fisheries (Huisman et al. 2018).

Overcompensatory growth of microalgae depends on improved cell division during the recovery stage, and bacterial STKs are known to regulate bacterial cell division (Manuse et al. 2016). pknA phosphorylates and regulates the functionality of FtsZ, a protein central to cell division throughout the bacterial lineage (Thakur & Chakraborti 2006). Interplay between PknA and PknB in mycobacteria allows phosphorylation of Wag31, an ortholog of the cell division protein DivIVA. PknA-mediated phosphorylation of both FtsZ and FipA stabilizes the FtsZ/FipA/FtsQ complex required for cell division under oxidative stress (Manuse et al. 2016). Giefing et al. (2010) proposed that StkP played a currently undefined role in cell division of pneumococcus based on its cell-division-dependent localization and interaction with FtsZ. Expression of pknA and pknB in Mycobacterium tuberculosis was markedly higher during exponential growth than during the stationary phase, suggesting that the regulatory function of these essential kinases was required during active cell replication (Kang et al. 2005). Following darkness stress, we found that expression of four STK genes (spkB, spkC, spkD, and spkF) was upregulated significantly in the initial recovery stage (from 0.5 to 4 h) and then downregulated after 4 h. Translation of transcribed STK genes into proteins and their regulation of growth via signal transduction requires time. As a result, overcompensatory growth of Microcystis appeared later than upregulated STK gene expression. We found that overcompensatory growth of Microcystis occurred at day 1 of light recovery from darkness and lasted for only 2 days, suggesting that STKs might play a role in overcompensatory growth of Microcystis by stimulating cell division.

STKs in Synechocystis might be involved in autophosphorylation and phosphorylation of general substrate proteins (Kamei et al. 2001, 2002, 2003), regulation of nitrogen metabolism (Galkin et al. 2003), post-translational modification of pilin for pili assembly (Kim et al. 2004), and acclimation to abiotic changes (Liang et al. 2011; Liu et al. 2013). To confirm the roles of STKs during overcompensatory growth of Microcystis after light-limitation stress, we heterologously expressed Microcystis spkD, an STK gene essential for survival of the species (Kamei et al. 2002; Laurent et al. 2008), in the model cyanobacterium Synechocystis. Both wild-type and transgenic Synechocystis exhibited overcompensatory growth in the light recovery stage. However, transgenic Synechocystis exhibited greater overcompensatory growth than wild-type Synechocystis. Moreover, overcompensatory growth of transgenic Synechocystis lasted longer than wild-type Synechocystis. These results suggested that heterologous expression of spkD had stimulatory effects on overcompensatory growth in Synechocystis. After light recovery, marked changes in the expression of STK genes accompanied the overcompensatory growth in transgenic Synechocystis. How Microcystis spkD affects STK genes expression when heterologously expressed in Synechocystis merits further investigation, which will help us to further declare the molecular mechanism underlying overcompensatory growth of cyanobacteria.

CONCLUSIONS

Microcystis exhibited overcompensatory growth following light-limitation stress, and overcompensatory growth might be considered a factor contributing to transient bursts of cyanobacterial biomass when algal blooms break out. The overcompensatory growth was accompanied by the changes of STK gene expression in Microcystis. Furthermore, heterologous expression of Microcystis spkD in Synechocystis had stimulation effects on the overcompensatory growth caused by light limitation. STK genes might play an important role in the overcompensatory growth of cyanobacteria.

ACKNOWLEGEMENTS

This research was funded by the National Natural Science Foundation of China (31640009 and 31772857), National Key Research and Development Program of Shandong (2018GSF121019), Key Laboratory of Algal Biology, Institute of Hydrobiology, Chinese Academy of Sciences (2018-006), Natural Science Foundation Grant of Tianjin (18JCYBJC95900, 18JCZDJC97800, and 19JCYBJC30000), the Fundamental Research Funds of Tianjin Universities (2020ZD06), and Tianjin Science and Technology Project (19YFZCSN00070).

DATA AVAILABILITY STATEMENT

All relevant data are included in the paper or its Supplementary Information.

REFERENCES

REFERENCES
Agarwal
S.
Pancholi
P.
Pancholi
V.
2011
Role of serine/threonine phosphatase (SP-STP) in Streptococcus pyogenes physiology and virulence
.
Journal of Biological Chemistry
286
(
48
),
41368
41380
.
Ali
M. A.
Nicieza
A. G.
Wootton
R. J.
2003
Compensatory growth in fishes, a response to growth depression
.
Fish and Fisheries
4
(
2
),
147
190
.
Chen
G.
Peng
Z. Y.
Shan
L.
Xuan
N.
Tang
G. Y.
Zhang
Y.
Li
L.
He
Q. F.
Bi
Y. P.
2012
Cloning of Acyl-ACP Thioesterase FatA from Arachis hypogaea L. and its Expression in Escherichia coli
.
Biomed Research International
2012
,
652579
.
Chen
G.
Qu
S. J.
Wang
Q.
Bian
F.
Peng
Z. Y.
Zhang
Y.
Ge
H. T.
Yu
J. H.
Xuan
N.
Bi
Y. P.
He
Q. F.
2014
Transgenic expression of delta-6 and delta-15 fatty acid desaturases enhances omega-3 polyunsaturated fatty acid accumulation in Synechocystis sp. PCC6803
.
Biotechnology for Biofuels
7
(
1
),
1
10
.
Galkin
A. N.
Mikheeva
L. E.
Shestakov
S. V.
2003
Insertional inactivation of genes encoding eukaryotic type serine/threonine protein kinases in cyanobacterium Synechocystis sp. PCC 6803
.
Mikrobiologiia
72
(
1
),
64
69
.
Haande
S.
Ballot
A.
Rohrlack
T.
Fastner
J.
Wiedner
C.
Edvardsen
B.
2007
Diversity of Microcystis aeruginosa isolates (Chroococcales, Cyanobacteria) from East African water bodies
.
Archives of Microbiology
188
(
1
),
15
25
.
Han
W.
Jing
Y.
Li
T.
2015
Compensatory growth in Microcystis aeruginosa after moderate high-temperature exposure
.
Journal of Limnology
74
(
3
),
549
558
.
Huisman
J.
Codd
G. A.
Paerl
H. W.
Ibelings
B. W.
Verspagen
J. M. H.
Visser
P. M.
2018
Cyanobacterial blooms
.
Nature Reviews Microbiology
16
,
471
483
.
Kaneko
T.
Sato
S.
Kotani
H.
Tanaka
A.
Asamizu
E.
Nakamura
Y.
Miyajima
N.
Hirosawa
M.
Sugiura
M.
Sasamoto
S.
Kimura
T.
Hosouchi
T.
Matsuno
A.
Muraki
A.
Nakazaki
N.
Naruo
K.
Okumura
S.
Shimpo
S.
Takeuchi
C.
Wada
T.
Watanabe
A.
Yamada
M.
Yasuda
M.
Tabata
S.
1996
Sequence analysis of the genome of the unicellular cyanobacterium Synechocystis sp. strain PCC6803. II. Sequence determination of the entire genome and assignment of potential protein-coding regions
.
DNA Research
3
(
3
),
185
209
.
Kang
C. M.
Abbott
D. W.
Park
S. T.
Dascher
C. C.
Cantley
L. C.
Husson
R. N.
2005
The Mycobacterium tuberculosis serine/threonine kinases PknA and PknB: substrate identification and regulation of cell shape
.
Genes and Development
19
(
14
),
1692
1704
.
Kim
Y. H.
Park
Y. M.
Kim
S. J.
Park
Y. I.
Choi
J. S.
Chung
Y. H.
2004
The role of slr1443 in pilus biogenesis in Synechocystis sp. PCC 6803: involvement in post-translational modification of pilins
.
Biochemical and Biophysical Research Communications
315
(
1
),
179
186
.
Liu
Z. X.
Li
H. C.
Wei
Y. P.
Chu
W. Y.
Shao
H. B.
2013
Signal transduction pathways in synechocystis sp. PCC 6803 and biotechnological implications under abiotic stress
.
Critical Reviews in Biotechnology
35
(
2
),
269
280
.
Los
D. A.
Zorina
A.
Sinetova
M.
Kryazhov
S.
Mironov
K.
Zinchenko
V. V.
2010
Stress sensors and signal transducers in cyanobacteria
.
Sensors
10
(
3
),
2386
2415
.
Manuse
S.
Fleurie
A.
Zucchini
L.
Lesterlin
C.
Grangeasse
C.
2016
Role of eukaryotic-like serine/threonine kinases in bacterial cell division and morphogenesis
.
FEMS Microbiology Reviews
40
(
1
),
41
56
.
Panichkin
V. B.
Arakawa-Kobayashi
S.
Kanaseki
T.
Suzuki
I.
Los
D. A.
Shestakov
S. V.
Murata
N.
2006
Serine/threonine protein kinase SpkA in Synechocystis sp. strain PCC 6803 is a regulator of expression of three putative pilA operons, formation of thick pili, and cell motility
.
Journal of Bacteriology
188
(
21
),
7696
7699
.
Pereira
S. F. F.
Goss
L.
Dworkin
J.
2011
Eukaryote-like serine/threonine kinases and phosphatases in bacteria
.
Microbiology and Molecular Biology Reviews
75
(
1
),
192
212
.
Rippka
R. J.
Deruelles
J.
Waterbury
J. B.
Herdman
M.
Stanier
R.
1979
Generic assignments, strain histories and properties of pure cultures of cyanobacteria
.
Journal of General Microbiology
111
(
1
),
1
61
.
Turano
M. J.
Borski
R. J.
Daniels
H. V.
2007
Compensatory growth of pond-reared hybrid striped bass, Moronechrysops × Moronesaxatilis, fingerlings
.
Journal of the World Aquaculture Society
38
(
2
),
250
261
.

Author notes

Wei Dai and Gao Chen are co-first authors of the article.

This is an Open Access article distributed under the terms of the Creative Commons Attribution Licence (CC BY 4.0), which permits copying, adaptation and redistribution, provided the original work is properly cited (http://creativecommons.org/licenses/by/4.0/).