Hospitals are considered an important factor in the spread of antibiotic-resistant bacteria (ARBs) and antibiotic-resistance genes (ARGs). The purpose of this research was to characterize the microbial populations in hospital wastewater and investigated the prevalence of β-lactamase, SulІ and QnrS resistance genes. In the first step, culture method was used to isolate Pseudomonas aeruginosa and Escherichia coli. In the next step, accurate identification of isolated bacteria was carried out using the polymerase chain reaction (PCR) method, then the resistance of the bacteria at different concentrations of antibiotics (8–128 μg/mL) was examined. Finally the ARGs were detected using the PCR method. The averages of heterotrophic plate count (HPC) and ARB concentration in wastewater samples were 1.8 × 108 and 4.3 × 106 CFU/100 mL, respectively. The highest resistance rates were found for sulfamethoxazole and the highest resistance rates in the β-lactamase group were for ceftazidime, while highest sensitivity was for gentamicin and there was no isolate that was sensitive to the studied antibiotics. SulІ and QnrS were the highest and lowest abundance of all ARGs in samples respectively and blaSHV was the highest β-lactam resistance gene. Our results indicated an increase in the resistance of identified bacteria to several antibiotics. So it can be concluded that numerous antibiotic-resistant pathogens and vast numbers of ARGs exist in the human body so that their release from hospitals without effective treatment can cause many dangers to the environment and human health.

  • In this study, five types of bacteria were extracted from EMB agar, two types of these bacteria were Escherichia coli.

  • The identified Escherichia coli both had the SUL, SHV, TEM genes and only one type of Escherichia coli CTX had the QnrS gene

  • The highest abundance of ARG, among identified Pseudomonas grown on cetrimide agar was sulfadimidine-resistance gene.

Hospital and health care centers discharge considerable amounts of microbial agents and pharmaceutical residues into sewage and municipal wastewaters. Antibiotics are an important group of pharmaceuticals that are widely used in hospitals to treat infectious diseases that finally enter the aquatic environment from various sources (Paulshus et al. 2019; Khan et al. 2020a). Also, the increasing resistance of pathogenic bacteria to multiple common antibiotics is an emergent global public health problem (Elhariri et al. 2017; Peymani et al. 2017; Khan et al. 2020b). Irrational use of antimicrobials in the last few decades has been converted the clinically important bacteria from susceptible to single and or multiple antibiotics resistant which has led to a threat in public health (Akther et al. 2018; Debnath et al. 2018). The occurrence and spread of antibiotic-resistant bacteria or antibiotic-resistance genes (ARB, ARGs) are pressing public health problems worldwide and aquatic ecosystems are becoming a recognized reservoir for these micropollutants (Hocquet et al. 2016; Hassoun-Kheir et al. 2020).

Hospitals are ecological niches for ARB and play a major role in the emergence and spread of these bacteria and contain higher levels of antibiotic-resistant enteric bacteria in wastewater effluents than derived from other sources (Lamba et al. 2017; Paulus et al. 2019). Bacteria resistance to antibiotics could advance different infectious disease threats to humans, since they can act as a reservoir for the maintenance and spread of ARGs (Devarajan et al. 2017). Also bacterial resistance to antibiotics may be caused through horizontal gene transfer or mutations in the bacterial population and increases the threats presented by antibiotic resistance (Joseph et al. 2019). β-Lactam antibiotics are the most commonly used drugs against infections because of their broad spectrum activity and low toxicity and are the largest type of antibiotic used by hospitals to treat infections caused by Gram-negative bacteria (Carlier et al. 2015; Ogbolu et al. 2018). The presence of β-lactam genes encoding blaSHV, blaTEM, blaCTX groups and VIM enzymes has been frequently reported in rivers in different regions over the world (Pérez-Etayo et al. 2020). Iran is one of the countries with the highest consumption of antibiotics and antibiotic resistance has been reported in almost all clinical, agricultural, livestock and environmental studies. Use of various antibiotics in different fields eventually causes these substances to enter human-related environments and causes ARB and ARG problems. For example, most antibiotics used in animal husbandry are consistently detected in livestock gastrointestinal environments that slow down the growth of susceptible bacterial populations. When ARBs in livestock gastrointestinal environments are excreted, ARGs are disseminated into receiving environments (e.g., soil, water) (Ogura et al. 2020). Subsequent ARG replication and propagation would increase the likelihood of human exposure. Therefore the consumption of antibiotics in any field provides the basis for the study of antibiotic resistance and, due to the nature of hospital wastewaters that are an important source of resistant bacteria, can be one of these fields. Considering that Escherichia coli and Pseudomonas aeruginosa due to their marked ability to survive on hospital surfaces are among the causative agents of nosocomial infections and given that increasing antimicrobial resistance in these bacteria has reduced the therapeutic potential against these pathogens and posed a challenge to human health, and as the World Health Organization and the Centers for Disease Control and Prevention in the United States have deemed these bacteria to be a serious threat worldwide (Willyard 2017), these bacteria were selected for this study. Due to the widespread use of different groups of antibiotics in medical environments, as well as the informal use of antibiotics by people and according to the results of previous studies on high-consumption antibiotics in the study area, ARGs were selected based on resistance to β-lactam (blaTEM, blaSHV, blaCTX, blaVIM), QnrS (reduced susceptibility to fluoroquinolones) and SulI (resistance to sulfonamides) genes. Including innovations of this study is that in addition to examining the resistance of bacteria to different groups of antibiotics, the resistance of bacteria to different concentrations of antibiotics was also examined separately. Regarding the study of ARGs, it should be noted that the presence of resistant genes was examined both before exposure to antibiotics and after exposure of identified bacteria to different concentrations of antibiotics.

Wastewater samples

Untreated wastewater samples, were obtained from the last manhole of sewerage collecting wastewater from Tabriz university-affiliated hospital in Iran. The hospital has 998 general beds, 120 emergency beds, 125 dialysis beds and 26 operating beds with an area of 72,500 m2.

Samples were taken twice during the year 2019 (warm and cold seasons) and to get a more representative sample 24 h composite samples were taken each period. Samples were collected in three periods in morning, noon and evening times. Samples were collected in sterilized glass bottles and then these bottles were refrigerated at 4 °C until processing in laboratory.

Isolation of bacteria and identification of resistant bacteria species

Cultivation of bacteria

For isolation of Pseudomonas aeruginosa cetrimide agar was used and eosin methylene blue (EMB) agar was used to isolate Escherichia coli from hospital wastewater samples. Samples were serially diluted with phosphate buffer to achieve an approximate range of 30 to 300 colonies on the plates. A total of 0.1 mL of diluted sample was placed on the agar plates in triplicate and then incubated aerobically at 37 °C for Escherichia coli 24 h and for Pseudomonas spp. 24–48 h. The different colonies grown on the culture medium were determined based on shape and morphology. Also heterotrophic plate count (HPC) were determined using R2A agar (Merck, Merck KGaA, Darmstadt, Germany) and incubated at 35 °C for 48–72 h.

Determination of bacteria resistance spectrum

Antibiotics belong to different antimicrobial classes with involving different mechanisms for resistance by inhibition of protein synthesis, folic-acid cycle, DNA gyrase (involved in DNA replication) and synthesis of cell walls.

In this research, the identified bacteria were dosed with four different antibiotics at concentrations of 8–128 μg/mL. The antibiotics were β-lactams (cefotaxime (Ctx), ceftriaxone (Cro), ceftazidime (Caz), cefixime (Cef), cefazolin (Cfz) imipenem (Ipm), gentamicin (Gm), sulfamethoxazole (SMX) and ciprofloxacin (CIP)) that were purchased from Sigma Chemical Company (Sigma Aldrich, UK).

PCR1 genome detection

DNA extraction

The DNA was extracted and purified using a bacterial genomic DNA extraction kit (TIANGEN, Beijing, China), according to manufacturer's instructions. DNA extraction was performed with three replicates of samples to compensate for heterogeneity. Then, the isolated DNA was stored at −20 °C until use.

DNA quantification

DNA concentration and purity were determined using a NanoDrop spectrophotometer by placing a drop (approximately 2 μL) on the sample space and analyzing using the software. (NanoDrop spectrophotometer, Thermo Scientific, Wilmington, USA).

Identification of bacteria using 16S rRNA

At the first step of the polymerase chain reaction (PCR), isolated bacteria were confirmed by amplification of the 16S rRNA gene. So primer set Eubac 27F and 1492R was used to amplify the 1,420 bp fragment of the 16S rRNA gene region of bacteria to check the nucleic acid extraction and the identification of inhibitors.

For this purpose, PCRs were carried out in a volume of 25 μL with 1 μL of genomic DNA, 0.50 mM of each primer, 12.5 μL master mix with amplification conditions given in Table 1. All PCR assays contained positive and negative controls.

Table 1

Sequences of primers and thermal condition used in PCR amplifications

GenePrimer sequence (5′ to 3′)Product size (bp)Annealing temperature (°C)References
27 F
1429 R 
AGAGTTTGATCCTGGCTCAG
TACGGYTACCTTGTTACGACTT 
1,420 bp 95 °C 5 min → 37_[95 °C 60 sec, 52 °C 30 sec, 72 °C 1 min, 30 s] → 72 °C 5 min Asghari et al. (2013)  
blaSHV GGTGACGAACAGCTGGAGCG
GAGTTCGCCGACCGTCATGC 
108 bp 94 °C 5 min → 40_[94 °C 60 sec, 62 °C 30 sec, 72 °C 10 sec] → 72 °C 5 min Designed for this study 
blaCTX TGGTGAYVTGGMTBAARGGCA
TGGGTRAARTARGTVACCAGAA 
175 bp 94 °C 5 min → 35_[94 °C 45 sec, 53 °C 45 sec, 72 °C 1 min] → 72 °C 5 min Deccache et al. (2015)  
blaTEM GCKGCCAACTTACTTCTGACAACG
CTTTATCCGCCTCCATCCAGTCTA 
247 bp 94 °C 5 min → 40_[94 °C 60 sec, 62 °C 30 sec, 72 °C 10 sec] → 72 °C 5 min Rodriguez-Mozaz et al. (2015); Pallares-Vega et al. (2019)  
blaVIM GTTTGGTCGCATATCGCAAC
AATGCGCAGCACCAGGATAG 
382 bp 94 °C 5 min → 35_[94 °C 60 sec, 60 °C 30 sec, 72 °C 10 sec] → 72 °C 5 min Aruhomukama et al. (2019)  
SulI CGCACCGGAAACATCGCTGCAC
TGAAGTTCCGCCGCAAGGCTCG 
163 bp 94 °C 5 min → 35_[94 °C 60 sec, 62 °C 30 sec, 72 °C 10 sec] → 72 °C 5 min Awad et al. (2015)  
QnrS GACGTGCTAACTTGCGTGAT
TGGCATTGTTGGAAACTTGC 
118 bp 94 °C 5 min → 35_[94 °C 60 sec, 60 °C 30 sec, 72 °C 10 sec] → 72 °C 5 min Calero-Cáceres et al. (2014)  
GenePrimer sequence (5′ to 3′)Product size (bp)Annealing temperature (°C)References
27 F
1429 R 
AGAGTTTGATCCTGGCTCAG
TACGGYTACCTTGTTACGACTT 
1,420 bp 95 °C 5 min → 37_[95 °C 60 sec, 52 °C 30 sec, 72 °C 1 min, 30 s] → 72 °C 5 min Asghari et al. (2013)  
blaSHV GGTGACGAACAGCTGGAGCG
GAGTTCGCCGACCGTCATGC 
108 bp 94 °C 5 min → 40_[94 °C 60 sec, 62 °C 30 sec, 72 °C 10 sec] → 72 °C 5 min Designed for this study 
blaCTX TGGTGAYVTGGMTBAARGGCA
TGGGTRAARTARGTVACCAGAA 
175 bp 94 °C 5 min → 35_[94 °C 45 sec, 53 °C 45 sec, 72 °C 1 min] → 72 °C 5 min Deccache et al. (2015)  
blaTEM GCKGCCAACTTACTTCTGACAACG
CTTTATCCGCCTCCATCCAGTCTA 
247 bp 94 °C 5 min → 40_[94 °C 60 sec, 62 °C 30 sec, 72 °C 10 sec] → 72 °C 5 min Rodriguez-Mozaz et al. (2015); Pallares-Vega et al. (2019)  
blaVIM GTTTGGTCGCATATCGCAAC
AATGCGCAGCACCAGGATAG 
382 bp 94 °C 5 min → 35_[94 °C 60 sec, 60 °C 30 sec, 72 °C 10 sec] → 72 °C 5 min Aruhomukama et al. (2019)  
SulI CGCACCGGAAACATCGCTGCAC
TGAAGTTCCGCCGCAAGGCTCG 
163 bp 94 °C 5 min → 35_[94 °C 60 sec, 62 °C 30 sec, 72 °C 10 sec] → 72 °C 5 min Awad et al. (2015)  
QnrS GACGTGCTAACTTGCGTGAT
TGGCATTGTTGGAAACTTGC 
118 bp 94 °C 5 min → 35_[94 °C 60 sec, 60 °C 30 sec, 72 °C 10 sec] → 72 °C 5 min Calero-Cáceres et al. (2014)  

PCR products were resolved by electrophoresis on 2.5% (wt/vol) agarose gels containing SYBR® Safe Stain together with a DNA molecular weight marker. Gels were viewed on a UV transilluminator (UV Tec., Vilber, France), and DNA fragment sizes were compared against the 1,000 bp ladder.

Identification ARB by DNA sequencing

PCR products were analyzed for DNA sequencing and DNA sequences analysis was undertaken using BLAST2 algorithms and databases from the National Center for Biotechnology (www.ncbi.nlm.nih.gov).

PCR sensitivity

McFarland turbidimetric standards were used to evaluate PCR sensitivity, which for this suspensions of all bacteria with concentration equivalent to 108 cells per mL were prepared. Then DNA was extracted from serial dilutions prepared from the suspensions and tested by PCR.

Detection of ARGs

The occurrence of genes resistant to β-lactams (blaTEM, blaSHV, blaCTX, blaVIM), fluoroquinolones (QnrS) and sulfonamides (SulІ) was tested using standard PCR reactions.

Specific primers to amplify the selected genes and thermal conditions used in PCR amplifications are presented in Table 1. For detection of these genes, PCR reactions were carried for example for 16S rRNA and the PCR products were resolved by electrophoresis on 1.5% (wt/vol) agarose gels.

Wastewater characterization

Physicochemical parameters including pH, biochemical oxygen demand (BOD5), COD chemical oxygen demand (COD) and total suspended solids (TSS) were determined in samples in accordance with Standard Methods for the Examination of Water and Wastewater (APHA et al. 2005).

The results of the physicochemical analysis of samples are presented in Table 2.

Table 2

Average values of physicochemical characteristics in hospital wastewater

ParameterAmount
pH 7.7–8 
BOD5, mg L−1 190 ± 35 
COD, mg L−1 350 ± 67 
SS, mg L−1 150 ± 20 
ParameterAmount
pH 7.7–8 
BOD5, mg L−1 190 ± 35 
COD, mg L−1 350 ± 67 
SS, mg L−1 150 ± 20 

Statistical analysis

Analysis of variance (ANOVA) was used to compare bacteria grown in different concentrations of antibiotics. Also the relationship between the number of bacteria isolated and physicochemical parameters was evaluated using the Pearson correlation matrix. All statistical analyses were performed in R version 3.5.0. P-values were used to assess significant differences between samples (P-value of <0.05).

Isolation of ARB in hospital wastewater

In this study, all bacteria grown on EMB and cetrimide agar without antibiotics were identified and counted. Five types of bacteria were isolated from EMB agar and five types of bacteria were isolated from cetrimide agar based on morphology.

Also since significant associations between the amount of HPC and nosocomial infection pathogen contamination have been reported in studies (Asghari et al. 2013), then, in this research HPCs also were examined in addition to the detection of Escherichia coli and Pseudomonas aeruginosa. Bacteria identified in hospital wastewater are presented in Table 3 and statistic estimation by Pearson correlation between numbers of isolated microorganisms from hospital effluents and these parameters is presented in Table 4.

Table 3

Identified bacteria in hospital wastewater

Type of bacteria(CFU/100 mL)
HPC 1.8 × 108 ± 3.5 × 107 
Detection of bacteria in antibiotic-free EMB agar 1.2 × 107 ± 2.4 × 106 
Detection of bacteria in antibiotic-free Cetrimide agar 5.4 × 106 ± 4.8 × 105 
Type of bacteria(CFU/100 mL)
HPC 1.8 × 108 ± 3.5 × 107 
Detection of bacteria in antibiotic-free EMB agar 1.2 × 107 ± 2.4 × 106 
Detection of bacteria in antibiotic-free Cetrimide agar 5.4 × 106 ± 4.8 × 105 
Table 4

Pearson correlation matrix among the isolated microorganism and physicochemical parameters

VariableBODCODARBTotal bacteria/antibiotic-free/EMB agarTotal bacteria/antibiotic-free/cetrimide agar
BOD  0.9    
COD      
HPC 0.83  0.87 0.73 0.9 
ARB 0.94     
SS 0.93 0.87    
Bacteria/antibiotic-free/EMB agar 0.91   0.96   0.71 
Bacteria/antibiotic-free/cetrimide agar 0.8  0.86   
VariableBODCODARBTotal bacteria/antibiotic-free/EMB agarTotal bacteria/antibiotic-free/cetrimide agar
BOD  0.9    
COD      
HPC 0.83  0.87 0.73 0.9 
ARB 0.94     
SS 0.93 0.87    
Bacteria/antibiotic-free/EMB agar 0.91   0.96   0.71 
Bacteria/antibiotic-free/cetrimide agar 0.8  0.86   

Detected bacteria were confirmed by PCR method and amplification of the 16S rRNA gene region. Based on BLAST, the two types of colonies identified on EMB agar were Escherichia coli and the five colonies identified on cetrimide agar were Pseudomonas aeruginosa (Table 5).

Table 5

Sequence based identification of hospital wastewater bacteria by BLAST searches

Closest match in GenBankIdentityAccession nos.
Bacteria grown on EMB agar E1 Acinetobacter baumannii 98.95% FJ907197.1 
E2 Enterobacter cloacae subsp. dissolvens 99.65% MN545624.1 
E3 Klebsiella pneumoniae subsp. rhinoscleromatis 98.84% LN624806.2 
E4 Escherichia coli 99.27% CP007390.1 
E5 Escherichia coli 97.02% MN094132.1 
Bacteria grown on cetrimide agar P1 Pseudomonas aeruginosa 99.43% MN700178.1 
P2 Pseudomonas aeruginosa 98.96% CP030328.1 
P3 Pseudomonas aeruginosa 97.86% KY885175.1 
P4 Pseudomonas aeruginosa 97.81% EU263017.1 
P5 Pseudomonas aeruginosa 98.67% CP028959.1 
Closest match in GenBankIdentityAccession nos.
Bacteria grown on EMB agar E1 Acinetobacter baumannii 98.95% FJ907197.1 
E2 Enterobacter cloacae subsp. dissolvens 99.65% MN545624.1 
E3 Klebsiella pneumoniae subsp. rhinoscleromatis 98.84% LN624806.2 
E4 Escherichia coli 99.27% CP007390.1 
E5 Escherichia coli 97.02% MN094132.1 
Bacteria grown on cetrimide agar P1 Pseudomonas aeruginosa 99.43% MN700178.1 
P2 Pseudomonas aeruginosa 98.96% CP030328.1 
P3 Pseudomonas aeruginosa 97.86% KY885175.1 
P4 Pseudomonas aeruginosa 97.81% EU263017.1 
P5 Pseudomonas aeruginosa 98.67% CP028959.1 

Bacterial resistance at different concentrations of antibiotics

The resistance of the identified bacteria at different concentrations of antibiotics 8–128 μg/mL was examined and the ability of these bacteria to grow at different concentrations was investigated.

Based on gene sequencing, two types of Escherichia coli were identified. These Escherichia coli had the ability to grow at concentrations of 8, 16 and 32 μg/mL of antibiotics and even the ability to grow at concentrations of 64 μg/mL of sulfamethoxazole, cefotaxime and ceftazidime antibiotics and only were able to grow at a concentration of 128 μg/mL sulfamethoxazole.

All the five species of Pseudomonas aeruginosa grew at concentrations of 8, 16 and 32 μg/mL of antibiotics. However, some of them (P1, P2, P3) were able to grow at a concentration of 64 μg/mL of sulfamethoxazole, cefotaxime, ceftazidime and cefixime antibiotics. Some of the isolated species (P1, P2) also grew at concentrations of 128 μg/mL of sulfamethoxazole.

It should be noted that all of identified bacteria were able to grow at concentrations of 8 and 16 μg/mL gentamicin and 8–32 μg/mL ciprofloxacin.

The results of this study are consistent with other studies on antibiotic resistance for different antibiotic members and the highest minimum inhibitory concentration (MIC) values for beta-lactam antibiotics are similar (Korzeniewska & Harnisz 2013; Akther et al. 2018). Also in a study by Pontes et al. on bacteria resistance to antibiotics, it was shown that bacteria are more sensitive to gentamicin, which is consistent with the present study (Pontes et al. 2009).

Based on our research on the ability of bacteria to be detected at different concentrations of antibiotic, all identified bacteria were able to grow at a concentration of 32 μg/mL antibiotics except for gentamicin. Figure 1 shows the ratio between the amount of bacteria grown in EMB and cetrimide agar with an antibiotic concentration of 32 μg/mL (16 μg/mL for gentamicin) to the amount of bacteria grown in both culture media without antibiotics.

Figure 1

Ratio of bacteria grown on medium with antibiotics/bacteria grown on medium without antibiotics.

Figure 1

Ratio of bacteria grown on medium with antibiotics/bacteria grown on medium without antibiotics.

As Figure 1 shows, the identified bacteria for the sulfamethoxazole antibiotic are more resistant to this than to other antibiotics and are more sensitive to gentamicin. Among the antibiotics of the beta-lactam group, the resistance of bacteria to ceftazidime was higher than to other antibiotics.

Analysis of variance (ANOVA) showed significant differences between the number of grown Escherichia coli (both species) at concentrations of 8 and 128 μg/mL sulfamethoxazole, 8 and 64 μg/mL ceftazidime and cefotaxime, but only there were significant differences between the number of the grown Pseudomonas aeruginosa at concentrations of 8 and 128 sulfamethoxazole (ANOVA, P < 0.05).

Antibiotic resistance gene detection

The PCR results for resistance genes are shown in Figure 2. PCR sensitivity was measured for all genes. According to the results of the PCR sensitivity tests, all the result were positive up to 1 CFU dilution.

Figure 2

Results of multiplex PCR for amplification of antibiotic-resistance genes.

Figure 2

Results of multiplex PCR for amplification of antibiotic-resistance genes.

The presence of genes encoding antibiotic resistance determinants in all isolated bacteria was assessed by PCR (Figure 3).

Figure 3

Prevalence of antibiotic-resistance genes in hospital wastewater samples.

Figure 3

Prevalence of antibiotic-resistance genes in hospital wastewater samples.

In this study, five types of bacteria were extracted from EMB agar, and were examined for the presence of resistance genes. Since two types of these bacteria were Escherichia coli, Escherichia coli ARGs are shown separately in this figure. The identified Escherichia coli both have the SulІ, blaSHV, blaTEM genes and only one type of Escherichia coli had the blaCTX and QnrS genes. And as shown in the figure, all the bacteria grown on the EMB agar had the SulІ gene.

The highest abundance of ARGs, among identified Pseudomonas aeruginosa was the sulfamethoxazole resistance gene, only one type of identified Pseudomonas aeruginosa had the QnrS gene and only one type of identified Pseudomonas aeruginosa had only one resistance gene.

It should be noted that 60% of identified Pseudomonas aeruginosa had the blaVIM resistance gene, 60% of Pseudomonas aeruginosa had the blaTEM and blaSHV resistance genes, and 40% of identified Pseudomonas aeruginosa had the blaCTX resistance gene. Table 6 shows the bacteria with the resistance genes.

Table 6

Resistant genes in isolated bacteria

Resistance gene pattern
Antibiotic pattern
Isolated bacteriaCtxTemShvVimSulІQnrSMDR
P1 MDR 
P2    MDR 
P3   MDR 
P4    MDR 
P5      MDR 
E3    MDR 
E4  MDR 
Resistance gene pattern
Antibiotic pattern
Isolated bacteriaCtxTemShvVimSulІQnrSMDR
P1 MDR 
P2    MDR 
P3   MDR 
P4    MDR 
P5      MDR 
E3    MDR 
E4  MDR 

Table 6 shows the presence of resistance genes in identified Pseudomonas aeruginosa and Escherichia coli. In different studies, similar results were obtained compared with the results of this study. Ranking of abundance of ARGs in our samples is almost similar to the other studies, so that genes encoding blaTEM, blaCTX and blaSHV were the most common types of β-lactams in bacteria and blaSHV has been the most prevalent in most studies (Uemura et al. 2010; Korzeniewska et al. 2013; Piotrowska et al. 2019).

In this study, the presence of ARGs was examined before the bacteria were exposed to antibiotics. The results of this stage of the study are shown in Table 7.

Table 7

Resistant genes in isolated bacteria before contact with antibiotics

Resistance gene
Isolated bacteriaCtxTemShvVimSulІQnrS
P1 − − − − 
P2 − − − − − 
P3 − − − − − 
P4 − − − − − − 
P5 − − − − − − 
E3 − − −  − 
E4 − −  − 
Resistance gene
Isolated bacteriaCtxTemShvVimSulІQnrS
P1 − − − − 
P2 − − − − − 
P3 − − − − − 
P4 − − − − − − 
P5 − − − − − − 
E3 − − −  − 
E4 − −  − 

The results indicated that some extracted bacteria before being exposed to antibiotics, had SulІ, blaTEM, blaSHV and blaVIM genes and that among these, the SulІ gene was observed in most samples before contact with antibiotics.

Findings of our study showed a high prevalence of Pseudomonas aeruginosa and Escherichia coli carrying ARGs in hospital wastewater and is a serious cause for concern. Since antibiotic resistance is a growing global public health threat the identification, treatment and management of these effluents are necessary. Because hospitals effluents without treatment are discharged to the sewer systems, they carry significant quantities of antibiotic-resistant bacteria to municipal sewage that is considered a source of ARBs and create problems such as public health risks and imbalance of the microbial community in the sewage systems, which in turn affects the biological treatment process. Hospital effluents have high concentrations of antibiotic groups and their metabolites, which could be the reason for the development of environmentally resistant genes. As hospital effluents are usually not treated and conventional treatment plants are inefficient in removing these pollutants, so hospital wastewater treatment at the source can be a good option for managing these pollutants and this option has advantages such as preventing dilution due to mixing with municipal wastewater, prevention of losses in the environment due to leakage and overflow of mixed wastewater and prevention of pathogens and ARBs entering the environment. In some cases it is necessary that new wastewater treatment processes be assessed for their capability to eliminate ARBs. Also in order to minimize the dispersion of ARBs and ARGs through effluents, it is necessary to implement effective methods of wastewater disinfection and surveillance programs.

This research was based on the results of previous studies and according to the studies performed on major antibiotics used in the studied hospital, to identify the antibiotic resistance of the extracted bacteria. Real conditions were prepared for the bacteria but, due to financial constraints, other antibiotics that were not widely used in this hospital were not studied; bacteria may be resistant to those antibiotics and may have other resistance genes. Generally new data and results generated in this study will help towards a better understanding of the diversity of ARBs and ARGs. Also the publication of such papers could help to amend legislation in countries with the aim to treat hospital wastewater before it is discharged into the sewage system or to use primary treatment of hospital effluents before their discharge into the main wastewater flow for later treatment in treatment plants.

However, given that results, patterns and the potential human risk of hospital wastewater discharges is still unclear, reporting standards need to be developed and adhered to in order to enable consolidation of data across studies in meta-analysis, which are essential for evidence-based policy decision making.

1

Polymerase chain reaction.

2

Basic Local Alignment Search Tool.

This research has been supported by the Tehran University of Medical Sciences (Grant No. 97-03-46-41302) as part of a PhD dissertation (IR.TUMS.VCR.REC.1398.241).

The authors declare that there is no conflict of interest regarding the publication of this paper.

All relevant data are included in the paper or its Supplementary Information.

Akther
S.
Debnath
T.
Chowdhury
M. M. H.
2018
Multidrug resistant E. coli in hospital waste water: a potential concern for public health
.
Advances in Biotechnology & Microbiology
8
.
doi:10.19080/AIBM.2018.08.555729
.
APHA, AWWA & WEF
2005
Standard Methods for the Examination of Water and Wastewater
, 21st edn.
APHA, AWWA & WEF
,
Washington, DC
.
Aruhomukama
D.
Najjuka
C. F.
Kajumbula
H.
Okee
M.
Mboowa
G.
Sserwadda
I.
Mayanja
R.
Joloba
M. L.
Kateete
D. P.
2019
blaVIM and blaOXA-mediated carbapenem resistance among Acinetobacter baumannii and Pseudomonas aeruginosa isolates from the Mulago hospital intensive care unit in Kampala, Uganda
.
BMC Infectious Diseases
19
.
doi:10.1186/s12879-019-4510-5
.
Asghari
F. B.
Nikaeen
M.
Mirhendi
H.
2013
Rapid monitoring of Pseudomonas aeruginosa in hospital water systems: a key priority in prevention of nosocomial infection
.
FEMS Microbiology Letters
343
,
77
81
.
doi:10.1111/1574-6968.12132
.
Awad
Y.
Kim
K. R.
Kim
S.-C.
Kim
K.
Lee
S. R.
Lee
S. S.
Sikok
Y.
2015
Monitoring antibiotic residues and corresponding antibiotic resistance genes in an agroecosystem
.
Chemistry
2015
.
doi:10.1155/2015/974843
.
Calero-cáceres
W.
Melgarejo
A.
Colomer-lluch
M.
Stoll
C.
Jofre
J.
Muniesa
M.
2014
Sludge as a potential important source of antibiotic resistance genes in both the 3 bacterial and bacteriophage fractions
.
Environmental Science & Technology
.
doi:10.1021/es501851s
.
Carlier
M.
Stove
V.
Wallis
S.
Waele
J. D.
Verstraete
A.
Lipman
J.
2015
Assays for therapeutic drug monitoring of beta-lactam antibiotics: a structured review
.
International Journal of Antimicrobial Agents Chemotherapy
46
,
367
375
.
doi:10.1016/j.ijantimicag.2015.06.016
.
Debnath
T.
Bhowmik
S.
Islam
T.
Chowdhury
M. H.
2018
Presence of multidrug-resistant bacteria on mobile phones of healthcare workers accelerates the spread of nosocomial infection and regarded as a threat to public health in Bangladesh
.
Journal of Microscopy and Ultrastructure
6
,
165
169
.
doi:10.4103/JMAU.JMAU_30_18
.
Deccache
Y.
Irenge
L. M.
Ambroise
J.
Savov
E.
Marinescu
D.
Chirimwami
R. B.
Gala
J. L.
2015
A qPCR and multiplex pyrosequencing assay combined with automated data processing for rapid and unambiguous detection of ESBL-producers Enterobacteriaceae
.
AMB Express
5
.
doi:10.1186/s13568-015-0136-1
.
Devarajan
N.
Keohler
T.
Mpiana
P. T.
Ibelings
B. W.
Pote
J.
2017
Antibiotic resistant Pseudomonas spp. in the aquatic environment: a prevalence study under tropical and temperate climate conditions
.
Water Research
115
,
256
265
.
doi:10.1016/j.watres.2017.02.058
.
ElharirI
M.
Hamza
D.
Elhelw
R.
Dorgham
S. M.
2017
Extended-spectrum beta-lactamase-producing Pseudomonas aeruginosa in camel in Egypt: potential human hazard
.
Annals of Clinical Microbiology and Antimicrobials
16
.
doi:10.1186/s12941-017-0197-x
.
Hassoun-kheir
N.
Stabholtz
Y.
Kreft
J.-U.
Cruz
R. D. L.
Romalde
J. L.
Nesme
J.
Srensen
S. J.
Smets
H. F.
Graham
D.
Paul
M.
2020
Comparison of antibiotic-resistant bacteria and antibiotic resistance genes abundance in hospital and community wastewater: a systematic review
.
Science of the Total Environment
743
.
doi:10.1016/j.scitotenv.2020.140804
.
Hocquet
D.
Muller
A.
Bertrand
X.
2016
What happens in hospitals does not stay in hospitals: antibiotic-resistant bacteria in hospital wastewater systems
.
Journal of Hospital Infection
.
doi:10.1016/j.jhin.2016.01.010
.
Joseph
S. M.
Battagli
T.
Maritz
J. M.
Carlton
J. M.
Blasera
M. J.
2019
Longitudinal comparison of bacterial diversity and antibiotic resistance genes in New York city sewage
.
mSystems
4
.
doi:10.1128/mSystems.00327-19
.
Khan
N. A.
Ahmed
S.
Farooqi
I. H.
I
A. L. I.
Vambol
V.
Changani
F.
Yousefi
M.
Vambol
S.
Khan
S. U.
Khan
A. H.
2020a
Occurrence, sources and conventional treatment techniques for various antibiotics present in hospital wastewaters: a critical review
.
Trends in Analytical Chemistry
129
.
doi:10.1016/j.trac.2020.115921
.
Khan
N. A.
Khan
S. U.
Ahmed
S.
Farooqi
I. H.
Yousefi
M.
Mohammadi
A. A.
Changani
F.
2020b
Recent trends in disposal and treatment technologies of emerging-pollutants-a critical review
.
TrAC Trends in Analytical Chemistry
122
.
doi:10.1016/j.trac.2019.115744
.
Korzeniewska
E.
Harnisz
M.
2013
Beta-lactamase-producing Enterobacteriaceae in hospital effluents
.
Journal of Environmental Management
123
,
7
1
.
doi:10.1016/j.jenvman.2013.03.024
.
Korzeniewska
E.
Korzeniewska
A.
Harnisz
M.
2013
Antibiotic resistant Escherichia coli in hospital and municipal sewage and their emission to the environment
.
Ecotoxicology and Environmental Safety
91
,
96
102
.
doi:10.1016/j.ecoenv.2013.01.014
.
Lamba
M.
Graham
D. W.
Ahammad
S. Z.
2017
Hospital wastewater releases of carbapenem resistance pathogens and genes in urban India
.
Environmental Science and Technology
51
.
doi:10.1021/acs.est.7b03380
.
Ogbolu
D. O.
Alli
O. A. T.
Webber
M. A.
Oluremi
A. S.
Oloyede
O. M.
2018
CTX-M-15 is established in most multidrug-resistant uropathogenic Enterobacteriaceae and Pseudomonaceae from hospitals in Nigeria
.
European Journal of Microbiology and Immunology
8
,
20
24
.
doi:10.1556/1886.2017.00012
.
Ogura
Y.
Ueda
T.
Nukazawa
K.
Hiroki
H.
Xie
H.
Arimizu
Y.
Hayashi
T.
Suzuki
Y.
2020
The level of antimicrobial resistance of sewage isolates is higher than that of river isolates in different Escherichia coli lineages
.
Scientific Reports
10
.
doi:10.1038/s41598-020-75065-x
.
Pallares-vega
R.
Blaak
H.
Plaats
R. V. D.
Husman
A. M. D. R.
Leal
L. H.
Loosdrecht
M. C. M. V.
Weissbrodt
D. G.
Schmitt
H.
2019
Determinants of presence and removal of antibiotic resistance genes during WWTP treatment: a cross-sectional study
.
Water Research
161
,
319
328
.
doi:10.1016/j.watres.2019.05.100
.
Paulshus
E.
Kühn
I.
Mollby
R.
Colque
P.
O'Sullivan
K.
Midtvedt
T.
Lingaas
E.
Holmstad
R.
Srum
H.
2019
Diversity and antibiotic resistance among Escherichia coli populations in hospital and community wastewater compared to wastewater at the receiving urban treatment plant
.
Water Research
232
241
.
doi:10.1016/j.watres.2019.05.102
.
Paulus
G. K.
Hornstra
L. M.
Alygizakis
N.
Slobodnik
J.
Thomaidis
N.
Medema
G.
2019
The impact of on-site hospital wastewater treatment on the downstream communal wastewater system in terms of antibiotics and antibiotic resistance genes
.
International Journal of Hygiene and Environmental Health
222
.
doi:10.1016/j.ijheh.2019.01.004
.
Pérez-etayo
L.
González
D.
J
L. E. I. V. A.
Vitas
A. I.
2020
Multidrug-resistant bacteria isolated from different aquatic environments in the north of Spain and south of France
.
Microorganisms
8
.
doi:10.3390/microorganisms8091425
.
Peymani
A.
Naserpour-farivar
T.
Zare
E.
Azarhoosh
K.
2017
Distribution of blaTEM, blaSHV, and blaCTX-M genes among ESBL-producing P. aeruginosa isolated from Qazvin and Tehran hospitals, Iran
.
Journal of Preventive Medicine and Hygiene
58
,
155
160
.
Piotrowska
M.
Kowalska
S.
Popowska
M.
2019
Diversity of β-lactam resistance genes in gram-negative rods isolated from a municipal wastewater treatment plant
.
Annals of Microbiology
69
,
591
601
.
doi:10.1007/s13213-019-01450-1
.
Pontes
D.
Pinheiro
F.
Lima-bittencourt
C.
Guedes
R.
Cursino
L.
Barbosa
F.
Santos
F.
Chartone-souza
E.
Nascimento
A.
2009
Multiple antimicrobial resistance of Gram-negative bacteria from natural oligotrophic lakes under distinct anthropogenic influence in a tropical region
.
Microbial Ecology
58
,
762
772
.
doi:10.1007/s00248-009-9539-3
.
Rodriguez-mozaz
S.
Chamorro
S.
Marti
E.
Huerta
B.
Gros
M.
Sànchez-melsiò
A.
Borrego
C. M.
Barcelò
D.
Balcàzar
J. L.
2015
Occurrence of antibiotics and antibiotic resistance genes in hospital and urban wastewaters and their impact on the receiving river
.
Water Research
69
,
234
242
.
doi:10.1016/j.watres.2014.11.021
.
Uemura
S.
Yokota
S.
Mizuno
H.
Sakawaki
E.
Sawamoto
K.
Maekawa
K.
Tanno
K.
Mori
K.
Asai
Y.
Fujii
N.
2010
Acquisition of a transposon encoding extended-spectrum beta-lactamase SHV-12 by Pseudomonas aeruginosa isolates during the clinical course of a burn patient
.
Antimicrobial Agents and Chemotherapy
54
,
3956
3959
.
doi:10.1128/AAC.00110-10
.
Willyard
C.
2017
The drug-resistant bacteria that pose the greatest health threats
.
Nature
28
(
543
),
15
.
doi:10.1038/nature.2017.21550
.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Licence (CC BY 4.0), which permits copying, adaptation and redistribution, provided the original work is properly cited (http://creativecommons.org/licenses/by/4.0/).