Abstract

Considering high concentrations of multidrug-resistant bacteria and antibiotic resistance genes (ARGs) in wastewater, agricultural reuse of treated wastewater may be a public health threat due to ARG dissemination in different environmental compartments, including soil and edible parts of crops. We investigated the presence of antibiotic-resistant Escherichia coli as an indicator bacterium from secondary treated wastewater (STWW), water- or wastewater-irrigated soil and crop samples. ARGs including blaCTX-m-32, blaOXA-23, tet-W, sul1, cml-A, erm-B, along with intI1 gene in E. coli isolates were detected via molecular methods. The most prevalent ARGs in 78 E. coli isolates were sul1 (42%), followed by blaCTX-m-32 (19%), and erm-B (17%). IntI1 as a class 1 integrons gene was detected in 46% of the isolates. Cml-A was detected in STWW isolates but no E. coli isolate from wastewater-irrigated soil and crop samples contained this gene. The results also showed no detection of E. coli in water-irrigated soil and crop samples. Statistical analysis showed a correlation between sul1 and cml-A with intI1. The results suggest that agricultural reuse of wastewater may contribute to the transmission of antibiotic-resistant bacteria to soil and crop. Further research is needed to determine the potential risk of ARB associated with the consumption of wastewater-irrigated crops.

HIGHLIGHTS

  • Antibiotic-resistant E. coli presented different abundance in STWW, irrigated soil and crops.

  • Antibiotic resistance genes were detected in high numbers of E. coli isolates.

  • sul1 was the most abundant ARG in the E. coli isolates.

  • Wastewater irrigation could aggravate antibiotic resistance in soil and crops.

INTRODUCTION

In recent decades, the excessive use of antibiotics as therapeutic drugs in humans, animals, and plants has caused selective pressure on bacterial populations, leading to the dissemination of antibiotic-resistant bacteria (ARB) and antibiotic resistance genes (ARGs) in the environment (Osińska et al. 2017; Yuan et al. 2020). As a result, World Health Organization (WHO) established antibiotic resistance (AR) as a critical global health concern of the 21st century (Campo et al. 2020; Yuan et al. 2020).

ARB and ARGs are mainly spread by various environmental compartments such as wastewater treatment plant (WWTP) effluents (Osińska et al. 2017), surface water (Koczura et al. 2012), livestock manure (Yuan et al. 2020), and agricultural environment (Bougnom et al. 2020). Wastewater as a nutrient-rich environment with a high microbial concentration and diversity provides favorite conditions for horizontal gene transfer (HGT) among bacteria (Osińska et al. 2017; Campo et al. 2020).

As communities are increasingly facing with water crisis, agricultural irrigation becomes a key point challenge, especially in arid and semi-arid areas. Therefore, wastewater reuse for agricultural activities is considered worldwide (Farhadkhani et al. 2018). Considering high concentrations of ARB and ARGs in the effluent of WWTPs, agricultural reuse of secondary treated wastewater (STWW) could considerably spread antibiotics, ARB and ARGs into the environment (Cerqueira et al. 2019a; Kumar et al. 2020). This may lead to an elevated resistance level in microbiome of soil and crops (Cerqueiraet al. 2019a, 2019b), thus threatening human and animal health. In other words, these environments turn into hotspots for ARB, ARGs, and mobile genetic elements (MGEs) (Yuan et al. 2020).

The increase in AR is facilitated by the association of ARGs with a variety of MGEs (Osińska et al. 2017). Integrons, as one of the genetic elements involved in the environmental spread of AR are found in MGEs such as plasmids and transposons, which promote their spread within bacterial communities (Cerqueira et al. 2019a). The common types of integrons which confer resistance to antibiotics including β-lactam antibiotics, chloramphenicol, sulfonamides, aminoglycoside, spectinomycin and others (Su et al. 2012) are class 1 integrons. This type of integrons are widely distributed in ARB, especially in Gram-negative bacteria (Osińska et al. 2017).

In this context, the presence of Gram-negative bacteria including Enterobacteriaceae members such as Escherichia coli in the environment as important vectors of ARGs, may pose a threat to human health (Cerqueira et al. 2019a). E. coli is a commensal bacterium which lives in the gut of humans and warm-blooded animals and could widely spread in different natural environments via feces or treated wastewater (Osińska et al. 2017). Furthermore, some pathogenic strains of E. coli can cause infectious diseases in animals and humans, such as urinary tract infections, diarrhea, and septicemia (Araújo et al. 2017).

It seems that E. coli, as an important indicator of fecal contamination, has an important role in the transfer of ARGs to pathogens (Holvoet et al. 2013; Araújo et al. 2017; Osińska et al. 2017). Therefore, the frequency of antibiotic-resistant E. coli in the environment can be used as a good estimate of the prevalence of other resistant pathogenic bacteria such as Salmonella (Holvoet et al. 2013). Conversely, determination of the resistance level of indicator bacteria may be useful to monitor the changes in the AR of the intestinal microbiota of human populations (Paulshus et al. 2019).

We surveyed the presence of antibiotic-resistant E. coli in STWW, water- or wastewater-irrigated soil and crop samples. Antibiotic resistance was determined by detecting six ARGs, including blaCTX-m-32, blaOXA-23, tet-W, sul1, cml-A, erm-B as well as intI1 gene (a key component of class 1 integrons) as a marker of anthropogenic pollution in E. coli isolates.

MATERIALS AND METHODS

Sample collection and preparation

This study was carried out in Isfahan, in the central part of Iran. In total, 51 samples including wastewater (18 samples); agricultural soil (18 samples) and crop (15 samples) were collected and analyzed for the presence of antibiotic-resistant E. coli.

Wastewater samples were collected from STWW of two WWTPs. Water- or wastewater-irrigated soil and crop samples were taken from agricultural fields. Soil samples were collected by an auger from the 0–20 cm topsoil layer. From each agricultural field a composite soil or crop sample consisting of three subsamples were analyzed. The edible parts of crop samples washed with tap water and 10−1 dilutions were prepared in sterile peptone water by homogenization for 3 minutes in a stomacher. A certain amount of each soil sample was also mixed with sterile peptone water (1:10 w/v) and then homogenized in a shaker incubator for 1 h.

All samples were taken in sterilized glass bottles or bags and were immediately transported to the laboratory for further processing.

E. coli isolation

For detection of E. coli, ten-fold serial dilutions (10−1–10−6) of samples were prepared. From all diluted samples, aliquots of 100 μL were plated onto lauryl sulphate MUG X-gal (LMX) agar in duplicate and incubated at 37 °C for 18–24 h. After incubation time the presence of E. coli in samples was determined by a light blue fluorescence of colonies under UV light (Farhadkhani et al. 2020). Finally, E. coli colonies were isolated using eosin methylene blue agar and incubated at 37 °C for 18–24 h.

Molecular detection of antibiotic resistance genes and class 1 integrons (intI1)

E. coli isolates were screened by PCR for detection of genes conferring resistance to β-lactam (blaCTX-m-32, blaOXA-23), tetracycline (tet-W), sulfonamide (sul1), chloramphenicol (cml-A), and macrolide (erm-B). The PCR amplification of intI1, was performed to evaluate the presence of class 1 integrons. PCR conditions and primer sets used for amplification of the genes are presented in Table 1.

Table 1

Primers used in the study

GenePrimerSequence (5′ → 3′)Amplified fragment (bp)Annealing temperature (°C)References
tet-W tet-W-F
tet-W -R 
GAGAGCCTGCTATATGCCAGC
GGGCGTATCCACAATGTTAAC 
168 64 Munir et al. (2011)  
sulsul1-F
sul1-R 
CGCACCGGAAACATCGCTGCAC
TGAAGTTCCGCCGCAAGGCTCG 
163 55.9 Munir et al. (2011)  
erm-B erm-B-F
erm-B-R 
AAAACTTACCCGCCATACCA
TTTGGCGTGTTTCATTGCTT 
193 60 Knapp et al. (2010)  
blaCTX-m-32 CTX-m-32-F
CTX-m-32-R 
CGTCACGCTGTTGTTAGGAA
CGCTCATCAGCACGATAAAG 
156 60 Mirhoseini et al. (2016)  
cml-A cml-F
cml-R 
TAGTTGGCGGTACTCCCTTG
GAATTGTGCTCGCTGTCGTA 
137 60.4 Aali et al. (2014)  
blaOXA-23 OXA-23-F
OXA-23-R 
GATCGGATTGGAGAACCAGA
ATTTCTGACCGCATTTCCAT 
501 54 Mirhoseini et al. (2016)  
intIintI1-F
intI1-R 
GCCTTGATGTTACCCGAGAG
GATCGGTCGAATGCGTGT 
196 60 Dungan et al. (2018)  
GenePrimerSequence (5′ → 3′)Amplified fragment (bp)Annealing temperature (°C)References
tet-W tet-W-F
tet-W -R 
GAGAGCCTGCTATATGCCAGC
GGGCGTATCCACAATGTTAAC 
168 64 Munir et al. (2011)  
sulsul1-F
sul1-R 
CGCACCGGAAACATCGCTGCAC
TGAAGTTCCGCCGCAAGGCTCG 
163 55.9 Munir et al. (2011)  
erm-B erm-B-F
erm-B-R 
AAAACTTACCCGCCATACCA
TTTGGCGTGTTTCATTGCTT 
193 60 Knapp et al. (2010)  
blaCTX-m-32 CTX-m-32-F
CTX-m-32-R 
CGTCACGCTGTTGTTAGGAA
CGCTCATCAGCACGATAAAG 
156 60 Mirhoseini et al. (2016)  
cml-A cml-F
cml-R 
TAGTTGGCGGTACTCCCTTG
GAATTGTGCTCGCTGTCGTA 
137 60.4 Aali et al. (2014)  
blaOXA-23 OXA-23-F
OXA-23-R 
GATCGGATTGGAGAACCAGA
ATTTCTGACCGCATTTCCAT 
501 54 Mirhoseini et al. (2016)  
intIintI1-F
intI1-R 
GCCTTGATGTTACCCGAGAG
GATCGGTCGAATGCGTGT 
196 60 Dungan et al. (2018)  

For PCR detection of the genes, genomic DNA was extracted from the E. coli isolates using a boiling technique. The PCR assay was performed in a 25 μL volume, as described previously (Farhadkhani et al. 2019). The PCR cycling conditions consisted of 5 minutes denaturation at 95 °C followed by 35 cycles of 94 °C for 45 seconds, annealing at varied temperatures (Table 1) for 45 seconds, polymerization at 72 °C for 45 seconds, and a final extension at 72 °C for 5 minutes. Positive and negative controls were included in all PCR assays. Analysis of the PCR products was performed by electrophoresis in a 1.5% (w/v) agarose gel and visualizing of gels by ultraviolet (UV) transilluminator (UV Tech, France).

Statistical analysis

Spearman's correlation was performed to assess the relationship between the presence of ARGs at a significance level (P-value) of <0.01. Statistical analyses were carried out using the statistical package SPSS software and Microsoft Excel (version 2016).

RESULTS AND DISCUSSION

Detection of E. coli

AS a part of the normal gut flora in warm-blooded animals, E. coli is a good indicator of the fecal pollution of environmental samples (Osińska et al. 2017). E. coli was detected in almost all STWW samples and 20% (3 of 15) and 13% (2 of 15) of soil and crop samples, respectively. E. coli was not detected in soil or crop samples irrigated with other types of water (well or channel water) which indicates no fecal pollution of the samples. Low detection frequency of E. coli in STWW-irrigated soil and crop samples, could be related to the environmental condition of the region. Environmental conditions of arid and semi-arid areas including high temperature, sunlight intensity and low humidity affect the survival of microorganisms in soil and on crop samples (Farhadkhani et al. 2018). In consistent with our results, E. coli was detected with a low frequency in wastewater-irrigated soil and crop samples despite relatively high levels in wastewater (Gatta et al. 2016; Farhadkhani et al. 2018).

In this work, 78 E. coli isolates were identified, including 62 isolates from STWW, 12 from the soil, and four from the crop samples. Detection of E. coli as a fecal indicator bacterium in wastewater-irrigated soil and crop samples indicates that agricultural reuse of wastewater may be a potential route for the transmission of pathogenic microorganisms and ARB to humans through the food chain.

Identification of antibiotic resistance genes

E. coli has great genomic plasticity in the nutritional aspects as well as the acquisition of MGEs, which highlights its importance as a vector for ARGs dissemination in the environment (Aristizábal-Hoyos et al. 2019).

Analysis of ARGs showed the presence of sul1, erm-B, blaCTX-m-32, cml-A, and intI1 genes in E. coli isolates with the highest frequency of detection for sul1. None of the isolates harbored tet-W and blaOXA-23 resistance genes (Table 2).

Table 2

Detection frequency of ARGs in E. coli isolates

Sample typeE. coli isolates harboring ARG/total of E. coli isolates (%)
tet-Wsul1erm-BblaCTX-m-32cml-AblaOXA-23intI1
STWW ND 24/62 (39) 8/62 (13) 9/62 (14) 6/62 (10) ND 35/62 (56) 
Soil ND 6/12 (50) 5/12 (42) 5/12 (42) ND ND ND 
Crop ND 3/4 (75) ND 1/4 (25) ND ND 1/4 (25) 
Total ND 33/78 (42) 13/78 (17) 15/78 (19) 6/78 (8) ND 36/78 (46) 
Sample typeE. coli isolates harboring ARG/total of E. coli isolates (%)
tet-Wsul1erm-BblaCTX-m-32cml-AblaOXA-23intI1
STWW ND 24/62 (39) 8/62 (13) 9/62 (14) 6/62 (10) ND 35/62 (56) 
Soil ND 6/12 (50) 5/12 (42) 5/12 (42) ND ND ND 
Crop ND 3/4 (75) ND 1/4 (25) ND ND 1/4 (25) 
Total ND 33/78 (42) 13/78 (17) 15/78 (19) 6/78 (8) ND 36/78 (46) 

ND: not detected, STWW: secondary treated wastewater.

In general, PCR assay revealed that 74% (58 of 78) of the E. coli isolates harbored at least one type of ARGs. sul1 which encodes the resistance to sulfonamide antibiotics, was the most abundant ARG (42%). The second most abundant gene was blaCTX-m-32 (19%), followed by erm-B (17%) and cml-A (8%). IntI1, class 1 integron gene, was detected in 46% of the isolates (Table 2).

Detection of the sul1 gene as the most frequent ARG in E. coli isolates consistent with the results of another study which reported that the presence of the gene was correlated to the presence of Beta and Gammaproteobacteria phylum's (e.g. Escherichia). These bacterial phylum's with a relatively high AR are generally found in wastewater (Cerqueira et al. 2019b). Besides, a higher frequency of sul1 gene in STWW may be related to long-time use of sulfonamides in medicine in the past years (Kumar et al. 2020). Other researches also addressed the detection of sulfonamide ARGs at higher concentrations than quinolone (qnr), macrolide (erm-B), and tetracycline (tet-W) resistance genes in environmental samples (Dungan et al. 2018; Kumar et al. 2020).

The high frequency of detection of blaCTX-m-32 gene in E. coli isolates is also consistent with other studies that found a great number of CTX-m-group resistance genes in environmental samples (Aristizábal-Hoyos et al. 2019). Yuan et al. (2020) reported that 97.35% of Escherichia spp. which isolated from livestock manure, hospital wastewater, and WWTPs carrying blaCTX-m. CTX-m-32 is a β-lactamase-encoding gene which confers resistance to cephalosporins (one of the antibiotic groups which is commonly used in clinical practice) (Aristizábal-Hoyos et al. 2019). Although the presence of β-lactam-resistant bacteria has mainly been described in hospital environments (Mirhoseini et al. 2016; Yuan et al. 2020), their occurrence in other environments such as agricultural crops, municipal WWTPs, and different water bodies (Koczura et al. 2012; Osińska et al. 2017; Aristizábal-Hoyos et al. 2019) indicates that ARB have the ability to disseminate in other environments besides the hospital environment (Aristizábal-Hoyos et al. 2019; Yuan et al. 2020).

As STWW isolates, the sul1 gene was detected with the highest frequency in soil and crop isolates, whereas the erm-B gene was not detected in crop samples. Cml-A with low frequency (10%) in STWW isolates was not detected in soil and crop samples (Table 2). This trend may be related to the relative abundance of genes in STWW. Conversely, it is most likely a consequence of ARB die-off when transferred from STWW to the soil and crop (Bougnom et al. 2020). However, other factors such as the presence of antibiotics, heavy metals, and antimicrobial disinfectant residues in STWW may influence ARGs frequency in the irrigated soils and crops (Dungan et al. 2018; Yuan et al. 2020).

Another interesting observation related to gene occurrence was that all detected ARGs in the soil and crop isolates were found in the STWW isolates. Some studies indicated the impact of WWTPs effluents on ARB dissemination in the receiving environments (Broszat et al. 2014; Chen et al. 2014). Although WWTPs play an important role to remove or minimize a wide range of pollutants, they may act as the main entry pathways of ARGs and ARB into the environment (Kumar et al. 2020). In addition, the chlorine-based disinfection in STWW could induce the discharge of ARGs from damaged microbial cells (Campo et al. 2020). Based on the results, using STWW for agricultural irrigation might contribute to the spread of ARG and ARB to the environment. A previous study conducted in Beijing and Tianjin, China indicated that soils receiving municipal wastewater in agricultural settings are enriched in ARGs (Chen et al. 2014), which supports the results of our study. For example, comparing ARG levels in the soil samples in China revealed that the relative abundance of sul1, sul 3, tet-A, tet-C, tet-E, tet-G, and tet-S were significantly higher in wastewater-irrigated soils than in non-irrigated soils (Chen et al. 2014). Detection of antibiotic-resistant E. coli in agricultural soils indicates that consumption of wastewater-irrigated crops may be a concern from a public health point of view (Bougnom et al. 2020).

Prevalence of multidrug resistance E. coli

Multidrug resistance (MDR) is defined as resistance to at least three different categories of antimicrobials agents (Osińska et al. 2017). High concentrations of MDR bacteria were detected in municipal wastewater, hospital wastewater, and livestock feeding drainage (Kumar et al. 2020). In our study, 9% of (7 of 78) E. coli isolates were multiresistant, 13% of the isolates harboring 2 ARGs, 33% of the isolates harboring 1 ARG, and 45% of them did not carry any resistance gene (Figure 1).

Figure 1

Percentage of E. coli strains harboring ARGs: (a) STWW, (b) Soil, (c) Crop, (d) Total.

Figure 1

Percentage of E. coli strains harboring ARGs: (a) STWW, (b) Soil, (c) Crop, (d) Total.

The results of this study revealed a small percentage of MDR (9%) E. coli compared with other studies (Osińska et al. 2017; Aristizábal-Hoyos et al. 2019). Osińska et al. (2017) reported that nearly 38% of E. coli strains isolated from river water and wastewater in Poland were MDR. Furthermore, 35% of E. coli strains isolated from treated wastewater were MDR, and 10% of isolates were resistant to one antibiotic. In addition, in Colombia 63.6% of E. coli isolates in the final WWTP were MDR (Aristizábal-Hoyos et al. 2019).

It is important to note that all the MDR isolates harbored sul1, erm-B, and blaCTX-m-32 resistance genes. It has been reported that MDR genotypes of β-lactam-resistant Enterobacteriaceae which have mainly been identified for resistance to sulfamethoxazole, were shown to have resistance caused by blaCTX-m (Bajaj et al. 2016).

The highest percentage of MDR was detected in E. coli strains isolated from the soil (42%) samples, whereas MDR was not observed in E. coli isolates from the crop samples (Figure 1). A previous study by Broszat et al. (2014) indicated that MDR presence is more noticeable in wastewater-irrigated soils (25%) than in rain-irrigated soils (6%).

Frequency of integron harboring E. coli

Integrons play a crucial role in the transfer and dissemination of antimicrobial resistance genes (Su et al. 2012). They can capture one or more gene cassettes and transfer them among different bacterial species, especially Gram-negative bacteria via the HGT mechanism (Su et al. 2012; Yuan et al. 2020). Our results showed the detection of intl1 in 46% (36 of 78) of E. coli isolates. The frequency of detection of intl1 in E. coli isolates is presented in Table 2. The highest level of detection was noted in STWW samples (35 of 62; 56%). A similar result was reported by Yuan et al. (2020) who found that 51.17% of E. coli strains isolated from municipal WWTPs harbored the intI1 gene. In contrast, Koczura et al. (2012) found that only 11% of E. coli strains which were recovered from WWTP harbored intl1.

Among the 36 isolates containing intI1, 75% (27 of 36) carried ARGs, indicating that 25% (9 of 36) of intl1 harboring isolates were free of ARG or carried other types of ARGs. Here, 25% of E. coli isolates recovered from the crop samples were integron positive whereas intl1 was completely absent in E. coli isolates of soil samples (Table 2). Furthermore, 6% (2 of 36) of integron harboring E. coli isolates were multiresistant. In the study carried out by Araújo et al. (2017) on irrigation of water and vegetables in household farms, 16% of E. coli isolates were found to be MDR among them, five isolates carried class 1 integrons.

As noted in previous studies, integrons are frequently found in livestock manure, urban wastewater, hospital wastewater (Yuan et al. 2020), agricultural ecosystems, and even in the water bodies not exposed to antibiotics (Araújo et al. 2017). The presence of intl1 imposes a higher potential for the dissemination of ARGs in the environment. Therefore, the consumption of crops contaminated with bacteria harboring intl1 may trigger a human health risk in terms of exposure to ARGs (Cerqueira et al. 2019a).

Spearman's correlation among ARGs and intI1 in the different sample types showed that the presence of erm-B gene was correlated with sul1 (r = 0.52) and blaCTX-m-32 (r = 0.39) (Figure 2). As mentioned earlier, these three ARGs were detected in all MDR isolates which indicates that these ARGs may be present in the same MGE (Cerqueira et al. 2019b).

Figure 2

Heat map of Spearman's correlation among ARGs and intI1. *Indicates the correlation is significant at the 0.01 level (2-tailed) according to Spearman's test.

Figure 2

Heat map of Spearman's correlation among ARGs and intI1. *Indicates the correlation is significant at the 0.01 level (2-tailed) according to Spearman's test.

The results showed that sul1(r = 0.30) and cml-A (r = 0.31) positively correlated with intI1. The correlation of sul1 with intI1 is related to the location of sul1 gene on 30-CS of the classic class 1 integrons (Su et al. 2012). Cml-A is one of the ARGs which confers resistance to chloramphenicol. The positive correlation between other chloramphenicol resistance genes (like cat) and intI1 was noted previously (Wu et al. 2011). The lack of correlation between intI1 and other AGRs may be attributed to the following reasons. Although the intI1 is known as an effective marker of antimicrobial resistance (Osińska et al. 2017), the occurrence of the gene is often associated with anthropogenic sources but not necessarily with the AR (Narciso-da-Rocha & Manaia 2017). Furthermore, integrons may be free of gene cassettes encoding AR. Recently, integrons without ARG cassettes were recovered from soils and sediments from the bacterial community (Zhang et al. 2009). However, the lack of significance may be related in part to the low numbers of E. coli isolates.

CONCLUSIONS

The results indicated the presence of E. coli isolates harboring ARGs and intI1 in the STWW, wastewater-irrigated soil and crop samples. Although the environmental conditions of arid and semi-arid areas may contribute to die-off of many ARB in soil and on crop surfaces, STWW could be a major source for ARB dissemination in the environment. Therefore, agricultural reuse of wastewater may be a risk factor for human health. Further studies are needed to estimate the risk of ARGs associated with the consumption of wastewater-irrigated crops for human health.

ACKNOWLEDGEMENT

This research was supported by the Vice Chancellery for Research at the Shahid Sadoughi University of Medical Sciences (Grant No. 5338).

DATA AVAILABILITY STATEMENT

All relevant data are included in the paper or its Supplementary Information.

REFERENCES

Aali
R.
Nikaeen
M.
Khanahmad
H.
Hassanzadeh
A.
2014
Monitoring and comparison of antibiotic resistant bacteria and their resistance genes in municipal and hospital wastewaters
.
International Journal of Preventive Medicine
5
(
7
),
887
894
.
Araújo
S.
Silva
I. A. T.
Tacão
M.
Patinha
C.
Alves
A.
Henriques
I.
2017
Characterization of antibiotic resistant and pathogenic Escherichia coli in irrigation water and vegetables in household farms
.
International Journal of Food Microbiology
257
,
192
200
.
https://doi.org/10.1016/j.ijfoodmicro.2017.06.020
.
Aristizábal-Hoyos
A. M.
Rodríguez
E. A.
Arias
L.
Jiménez
J. N.
2019
High clonal diversity of multidrug-resistant and extended spectrum beta-lactamase-producing Escherichia coli in a wastewater treatment plant
.
Journal of Environmental Management
245
,
37
47
.
https://doi.org/10.1016/j.jenvman.2019.05.073
.
Bajaj
P.
Singh
N. S.
Virdi
J. S.
2016
Escherichia coli β-lactamases: what really matters
.
Frontiers in Microbiology
7
,
1
14
.
https://doi.org/10.3389/fmicb.2016.00417
.
Bougnom
B. P.
Thiele-Bruhn
S.
Ricci
V.
Zongo
C.
Piddock
L. J. V.
2020
Raw wastewater irrigation for urban agriculture in three African cities increases the abundance of transferable antibiotic resistance genes in soil, including those encoding extended spectrum β-lactamases (ESBLs)
.
Science of the Total Environment
698
,
134201
.
https://doi.org/10.1016/j.scitotenv.2019.134201
.
Broszat
M.
Nacke
H.
Blasi
R.
Siebe
C.
Huebner
J.
Daniel
R.
Grohmanna
E.
2014
Wastewater irrigation increases the abundance of potentially harmful Gammaproteobacteria in soils in Mezquital Valley, Mexico
.
Applied and Environmental Microbiology
80
(
17
),
5282
5291
.
https://doi.org/10.1128/AEM.01295-14
.
Campo
N.
De Flora
C.
Maffettone
R.
Manoli
K.
Sarathy
S.
Santoro
D.
Gonzalez-Olmos
R.
Auset
M.
2020
Inactivation kinetics of antibiotic resistant Escherichia coli in secondary wastewater effluents by peracetic and performic acids
.
Water Research
169
,
115227
.
https://doi.org/10.1016/j.watres.2019.115227
.
Cerqueira
F.
Matamoros
V.
Bayona
J.
Elsinga
G.
Hornstra
L. M.
Piña
B.
2019a
Distribution of antibiotic resistance genes in soils and crops. A field study in legume plants (Vicia faba L.) grown under different watering regimes
.
Environmental Research
170
,
16
25
.
https://doi.org/10.1016/j.envres.2018.12.007
.
Cerqueira
F.
Matamoros
V.
Bayona
J.
Piña
B.
2019b
Antibiotic resistance genes distribution in microbiomes from the soil–plant–fruit continuum in commercial lycopersicon esculentum fields under different agricultural practices
.
Science of the Total Environment
652
,
660
670
.
https://doi.org/10.1016/j.scitotenv.2018.10.268
.
Chen
C.
Li
J.
Chen
P.
Ding
R.
Zhang
P.
Li
X.
2014
Occurrence of antibiotics and antibiotic resistances in soils from wastewater irrigation areas in Beijing and Tianjin, China
.
Environmental Pollution
193
,
94
101
.
https://doi.org/10.1016/j.envpol.2014.06.005
.
Dungan
R. S.
McKinney
C. W.
Leytem
A. B.
2018
Tracking antibiotic resistance genes in soil irrigated with dairy wastewater
.
Science of the Total Environment
635
,
1477
1483
.
https://doi.org/10.1016/j.scitotenv.2018.04.020
.
Farhadkhani
M.
Nikaeen
M.
Yadegarfar
G.
Hatamzadeh
M.
Pourmohammadbagher
H.
Sahbaei
Z.
Rahmani
H. R.
2018
Effects of irrigation with secondary treated wastewater on physicochemical and microbial properties of soil and produce safety in a semi-arid area
.
Water Research
144
,
356
364
.
https://doi.org/10.1016/j.watres.2018.07.047
.
Farhadkhani
M.
Nikaeen
M.
Hassanzadeh
A.
Nikmanesh
B.
2019
Potential transmission sources of Helicobacter pylori infection: detection of H. pylori in various environmental samples
.
Journal of Environmental Health Science and Engineering
17
(
1
),
129
134
.
https://doi.org/10.1007/s40201-018-00333-y
.
Farhadkhani
M.
Nikaeen
M.
Hadi
M.
Gholipour
S.
Yadegarfar
G.
2020
Campylobacter risk for the consumers of wastewater-irrigated vegetables based on field experiments
.
Chemosphere
251
,
126408
.
https://doi.org/10.1016/j.chemosphere.2020.126408
.
Gatta
G.
Libutti
A.
Beneduce
L.
Gagliardi
A.
Disciglio
G.
Lonigro
A.
Tarantino
E.
2016
Reuse of treated municipal wastewater for globe artichoke irrigation: assessment of effects on morpho-quantitative parameters and microbial safety of yield
.
Scientia Horticulturae
213
,
55
65
.
https://doi.org/10.1016/j.scienta.2016.10.011
.
Holvoet
K.
Sampers
I.
Callens
B.
Dewulf
J.
Uyttendaele
M.
2013
Moderate prevalence of antimicrobial resistance in Escherichia coli isolates from lettuce, irrigation water, and soil
.
Applied and Environmental Microbiology
79
(
21
),
6677
6683
.
https://doi.org/10.1128/AEM.01995-13
.
Knapp
C. W.
Zhang
W.
Sturm
B. S. M.
Graham
D. W.
2010
Differential fate of erythromycin and beta-lactam resistance genes from swine lagoon waste under different aquatic conditions
.
Environmental Pollution
158
(
5
),
1506
1512
.
https://doi.org/10.1016/j.envpol.2009.12.020
.
Koczura
R.
Mokracka
J.
Jabłońska
L.
Gozdecka
E.
Kubek
M.
Kaznowski
A.
2012
Antimicrobial resistance of integron-harboring Escherichia coli isolates from clinical samples, wastewater treatment plant and river water
.
Science of the Total Environment
414
,
680
685
.
https://doi.org/10.1016/j.scitotenv.2011.10.036
.
Kumar
M.
Ram
B.
Sewwandi
H.
Sulfikar
Honda
R.
Chaminda
T.
2020
Treatment enhances the prevalence of antibiotic-resistant bacteria and antibiotic resistance genes in the wastewater of Sri Lanka, and India
.
Environmental Research
183
.
https://doi.org/10.1016/j.envres.2020.109179
Mirhoseini
S. H.
Nikaeen
M.
Shamsizadeh
Z.
Khanahmad
H.
2016
Hospital air: a potential route for transmission of infections caused by β-lactam–resistant bacteria
.
American Journal of Infection Control
44
(
8
).
https://doi.org/10.1016/j.ajic.2016.01.041
Munir
M.
Wong
K.
Xagoraraki
I.
2011
Release of antibiotic resistant bacteria and genes in the effluent and biosolids of five wastewater utilities in Michigan
.
Water Research
45
(
2
),
681
693
.
https://doi.org/10.1016/j.watres.2010.08.033
.
Narciso-da-Rocha
C.
Manaia
C. M.
2017
The influence of the autochthonous wastewater microbiota and gene host on the fate of invasive antibiotic resistance genes
.
Science of the Total Environment
575
,
932
940
.
https://doi.org/10.1016/j.scitotenv.2016.09.157
.
Osińska
A.
Korzeniewska
E.
Harnisz
M.
Niestępski
S.
2017
The prevalence and characterization of antibiotic-resistant and virulent Escherichia coli strains in the municipal wastewater system and their environmental fate
.
Science of the Total Environment
577
,
367
375
.
https://doi.org/10.1016/j.scitotenv.2016.10.203
.
Paulshus
E.
Kühn
I.
Möllby
R.
Colque
P.
O'Sullivan
K.
Midtvedt
T.
Lingaas
E.
Holmstad
R.
Sørum
H.
2019
Diversity and antibiotic resistance among Escherichia coli populations in hospital and community wastewater compared to wastewater at the receiving urban treatment plant
.
Water Research
161
,
232
241
.
https://doi.org/10.1016/j.watres.2019.05.102
.
Su
H. C.
Ying
G. G.
Tao
R.
Zhang
R. Q.
Zhao
J. L.
Liu
Y. S.
2012
Class 1 and 2 integrons, sul resistance genes and antibiotic resistance in Escherichia coli isolated from Dongjiang River, South China
.
Environmental Pollution
169
,
42
49
.
https://doi.org/10.1016/j.envpol.2012.05.007
.
Wu
R. B.
Alexander
T. W.
Li
J. Q.
Munns
K.
Sharma
R.
McAllister
T. A.
2011
Prevalence and diversity of class 1 integrons and resistance genes in antimicrobial-resistant Escherichia coli originating from beef cattle administered subtherapeutic antimicrobials
.
Journal of Applied Microbiology
111
(
2
),
511
523
.
https://doi.org/10.1111/j.1365-2672.2011.05066.x
.
Yuan
W.
Tian
T.
Yang
Q.
Riaz
L.
2020
Transfer potentials of antibiotic resistance genes in Escherichia spp. strains from different sources
.
Chemosphere
246
,
125736
.
https://doi.org/10.1016/j.chemosphere.2019.125736
.
Zhang
X. X.
Zhang
T.
Zhang
M.
Fang
H. H. P.
Cheng
S. P.
2009
Characterization and quantification of class 1 integrons and associated gene cassettes in sewage treatment plants
.
Applied Microbiology and Biotechnology
82
(
6
),
1169
1177
.
https://doi.org/10.1007/s00253-009-1886-y
.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Licence (CC BY 4.0), which permits copying, adaptation and redistribution, provided the original work is properly cited (http://creativecommons.org/licenses/by/4.0/).